PMP70 (ABCD3) (NM_001122674) Human Untagged Clone

CAT#: SC318802

ABCD3 (untagged)-Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 2



  "NM_001122674" in other vectors (6)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PMP70/ABCD3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ABC43; CBAS5; PMP70; PXMP1; ZWS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318802 representing NM_001122674.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCCTTCAGCAAGTACTTGACGGCGCGAAACTCCTCGCTGGCTGGTGCCGCGTTCCTGCTGCTC
TGCCTGCTCCACAAGCGGCGCCGCGCCCTCGGCCTGCACGGTAAGAAAAGTGGAAAACCACCATTACAG
AACAATGAGAAAGAGGGGAAAAAGGAGCGAGCTGTGGTGGACAAGGTGTTTTTCTCAAGGCTCATACAG
ATTCTGAAAATCATGGTCCCTAGAACATTTTGTAAAGAGACAGGTTACTTGGTACTTATTGCTGTTATG
CTGGTGTCTCGAACATATTGTGATGTTTGGATGATTCAAAATGGGACACTAATTGAAAGTGGTATCATT
GGTCGTAGCAGGAAAGATTTCAAGAGATACTTACTCAACTTCATCGCTGCCATGCCTCTTATCTCTCTG
GTTAATAACTTCTTGAAGTATGGGTTAAATGAGCTTAAACTGTGCTTCCGAGTAAGGCTCACTAAATAC
CTCTATGAGGAGTATCTTCAAGCTTTCACATATTATAAAATGGGGAATCTGGACAACAGAATAGCTAAT
CCAGACCAGCTGCTTACACAAGATGTAGAAAAATTTTGTAACAGTGTAGTCGATCTGTATTCAAATCTT
AGTAAGCCATTTTTAGACATAGTTTTGTATATCTTTAAGTTAACGAGTGCAATTGGAGCTCAGGTACTT
GGAAAAATTTTGTGGCATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001122674
Insert Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001122674.1
RefSeq Size 967 bp
RefSeq ORF 711 bp
Locus ID 5825
UniProt ID P28288
Protein Families Druggable Genome, Transmembrane
Protein Pathways ABC transporters
MW 27.1 kDa
Gene Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has multiple differences in the 3' coding region and 3' UTR and contains an alternate exon in the central coding region, compared to variant 1, that results in a protein (isoform b) with a shorter, distinct C-terminus when compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...