PMP70 (ABCD3) (NM_001122674) Human Untagged Clone
CAT#: SC318802
ABCD3 (untagged)-Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ABC43; CBAS5; PMP70; PXMP1; ZWS2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC318802 representing NM_001122674.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCCTTCAGCAAGTACTTGACGGCGCGAAACTCCTCGCTGGCTGGTGCCGCGTTCCTGCTGCTC TGCCTGCTCCACAAGCGGCGCCGCGCCCTCGGCCTGCACGGTAAGAAAAGTGGAAAACCACCATTACAG AACAATGAGAAAGAGGGGAAAAAGGAGCGAGCTGTGGTGGACAAGGTGTTTTTCTCAAGGCTCATACAG ATTCTGAAAATCATGGTCCCTAGAACATTTTGTAAAGAGACAGGTTACTTGGTACTTATTGCTGTTATG CTGGTGTCTCGAACATATTGTGATGTTTGGATGATTCAAAATGGGACACTAATTGAAAGTGGTATCATT GGTCGTAGCAGGAAAGATTTCAAGAGATACTTACTCAACTTCATCGCTGCCATGCCTCTTATCTCTCTG GTTAATAACTTCTTGAAGTATGGGTTAAATGAGCTTAAACTGTGCTTCCGAGTAAGGCTCACTAAATAC CTCTATGAGGAGTATCTTCAAGCTTTCACATATTATAAAATGGGGAATCTGGACAACAGAATAGCTAAT CCAGACCAGCTGCTTACACAAGATGTAGAAAAATTTTGTAACAGTGTAGTCGATCTGTATTCAAATCTT AGTAAGCCATTTTTAGACATAGTTTTGTATATCTTTAAGTTAACGAGTGCAATTGGAGCTCAGGTACTT GGAAAAATTTTGTGGCATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001122674 |
Insert Size | 711 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001122674.1 |
RefSeq Size | 967 bp |
RefSeq ORF | 711 bp |
Locus ID | 5825 |
UniProt ID | P28288 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | ABC transporters |
MW | 27.1 kDa |
Gene Summary | The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has multiple differences in the 3' coding region and 3' UTR and contains an alternate exon in the central coding region, compared to variant 1, that results in a protein (isoform b) with a shorter, distinct C-terminus when compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225294 | ABCD3 (Myc-DDK-tagged)-Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 2 |
CNY 2400.00 |
|
RC225294L1 | Lenti ORF clone of Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC225294L2 | Lenti ORF clone of Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC225294L3 | Lenti ORF clone of Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC225294L4 | Lenti ORF clone of Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG225294 | ABCD3 (tGFP-tagged) - Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 2 |
CNY 4370.00 |