ARL17B (ARL17A) (NM_001113738) Human Untagged Clone
CAT#: SC318789
ARL17A (untagged)-Human ADP-ribosylation factor-like 17A (ARL17A), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARF1P2; ARL17P1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001113738 edited
ATGGGAAACATTTTTGAAAAGCTCTTTAAAAGTCTACTTGGGAAAAAAAAGATGCGGATT CTTATATTGAGTTTGGATACAGCTGGAAAAACCACCATCTTGTATAAATTGAAGCTGGGG GAGACTGTGCCTGCCGTCCCTACAGTAGGTTTCTGTGTGGAGACAGTAGAATATAAAAAT AACACCTTCGCTGTCTGGGATGTTGGCAGCCACTTCAAAATCAGACCTCTGTGGCAGCAT TTTTTCCAGAACACAAAAGGTGCCAGAAGCCCAGGAAGCACACATCAAGGCTCACTTGCC AGCGGGGTGCTGCCAATAAAATGTAGTCACGTGGAATTTGGAATGTGGAAAGGAGGTAGA AGTCATCCTTTCCTCCCCCATAGCAGCAGGTGTGCAGGCTCTGGTGGTCAGCTGGACTCC ATACTCCCCCACCAGTCACCAGCCTGGGGACCGTGGGGCTGCAAGGACCTCAGCAGCGGT TTCCCAAGTTTCCTGACTTCTTCCATCCTCTGGAAATCAGCTGTGGTAAAGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001113738 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001113738.1, NP_001107210.1 |
RefSeq Size | 5273 bp |
RefSeq ORF | 534 bp |
Locus ID | 51326 |
UniProt ID | Q8IVW1 |
Gene Summary | GTP-binding protein that functions as an allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. Involved in protein trafficking; may modulate vesicle budding and uncoating within the Golgi apparatus (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225186 | ARL17A (Myc-DDK-tagged)-Human ADP-ribosylation factor-like 17A (ARL17A), transcript variant 1 |
CNY 2400.00 |
|
RC225186L3 | Lenti-ORF clone of ARL17A (Myc-DDK-tagged)-Human ADP-ribosylation factor-like 17A (ARL17A), transcript variant 1 |
CNY 5890.00 |
|
RC225186L4 | Lenti-ORF clone of ARL17A (mGFP-tagged)-Human ADP-ribosylation factor-like 17A (ARL17A), transcript variant 1 |
CNY 5890.00 |
|
RG225186 | ARL17A (tGFP-tagged) - Human ADP-ribosylation factor-like 17A (ARL17A), transcript variant 1 |
CNY 4370.00 |