ARL17B (ARL17A) (NM_001113738) Human Untagged Clone

CAT#: SC318789

ARL17A (untagged)-Human ADP-ribosylation factor-like 17A (ARL17A), transcript variant 1



  "NM_001113738" in other vectors (4)

CNY 3990.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARF1P2; ARL17P1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001113738 edited
ATGGGAAACATTTTTGAAAAGCTCTTTAAAAGTCTACTTGGGAAAAAAAAGATGCGGATT
CTTATATTGAGTTTGGATACAGCTGGAAAAACCACCATCTTGTATAAATTGAAGCTGGGG
GAGACTGTGCCTGCCGTCCCTACAGTAGGTTTCTGTGTGGAGACAGTAGAATATAAAAAT
AACACCTTCGCTGTCTGGGATGTTGGCAGCCACTTCAAAATCAGACCTCTGTGGCAGCAT
TTTTTCCAGAACACAAAAGGTGCCAGAAGCCCAGGAAGCACACATCAAGGCTCACTTGCC
AGCGGGGTGCTGCCAATAAAATGTAGTCACGTGGAATTTGGAATGTGGAAAGGAGGTAGA
AGTCATCCTTTCCTCCCCCATAGCAGCAGGTGTGCAGGCTCTGGTGGTCAGCTGGACTCC
ATACTCCCCCACCAGTCACCAGCCTGGGGACCGTGGGGCTGCAAGGACCTCAGCAGCGGT
TTCCCAAGTTTCCTGACTTCTTCCATCCTCTGGAAATCAGCTGTGGTAAAGTAG
Restriction Sites Please inquire     
ACCN NM_001113738
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001113738.1, NP_001107210.1
RefSeq Size 5273 bp
RefSeq ORF 534 bp
Locus ID 51326
UniProt ID Q8IVW1
Gene Summary GTP-binding protein that functions as an allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. Involved in protein trafficking; may modulate vesicle budding and uncoating within the Golgi apparatus (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...