TEN1 (NM_001113324) Human Untagged Clone
CAT#: SC318765
TEN1 (untagged)-Human chromosome 17 open reading frame 106 (C17orf106)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C17orf106 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001113324, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCCAAACCTGGGACCTATTACCTCCCCTGGGAGGTTAGTGCAGGCCAAGTTCCT GATGGGAGCACGCTGAGAACATTTGGCAGGTTGTGCCTCTATGACATGATTCAGTCCAGA GTAACACTGATGGCTCAGCACGGATCCGATCAGCACCAGGTTCTTGTCTGTACCAAGTTG GTGGAGCCCTTCCACGCCCAGGTGGGCTCCCTGTACATCGTCCTCGGGGAGCTCCAGCAT CAGCAGGACAGAGGCTCCGTGGTGAAGGCGCGCGTGCTGACCTGTGTGGAGGGGATGAAC CTGCCCTTGTTGGAACAAGCCATCCGGGAGCAGAGACTGTACAAGCAGGAGCGGGGCGGC AGCCAG |
Restriction Sites | Please inquire |
ACCN | NM_001113324 |
Insert Size | 1010 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001113324.1, NP_001106795.1 |
RefSeq Size | 1010 bp |
RefSeq ORF | 369 bp |
Locus ID | 100134934 |
UniProt ID | Q86WV5 |
Gene Summary | C17ORF106, or TEN1, appears to function in a telomere-associated complex with STN1 (OBFC1; MIM 613128) and CTC1 (C17ORF68; MIM 613129) (Miyake et al., 2009 [PubMed 19854130]).[supplied by OMIM, Nov 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225063 | TEN1 (Myc-DDK-tagged)-Human chromosome 17 open reading frame 106 (C17orf106) |
CNY 1200.00 |
|
RC225063L3 | Lenti-ORF clone of TEN1 (Myc-DDK-tagged)-Human chromosome 17 open reading frame 106 (C17orf106) |
CNY 5890.00 |
|
RC225063L4 | Lenti-ORF clone of TEN1 (mGFP-tagged)-Human chromosome 17 open reading frame 106 (C17orf106) |
CNY 5890.00 |
|
RG225063 | TEN1 (tGFP-tagged) - Human chromosome 17 open reading frame 106 (C17orf106) |
CNY 4370.00 |