TSTD1 (NM_001113205) Human Untagged Clone
CAT#: SC318762
TSTD1 (untagged)-Human thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 (TSTD1), transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KAT; TST |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001113205, the custom clone sequence may differ by one or more nucleotides
ATGGCTGGAGCGCCCACGGTCTCGCTTCCTGAACTCCGTTCACTCCTAGCCTCCGGACGG GCCCGGCTCTTCGACGTGCGCTCTCGCGAGGAGGCGGCAGCTGGGACCATCCCAGGGGCG CTCAACATCCCGGTGTCCGAGTTGGAGAGTGCTCTGCAGATGGAGCCAGCTGCCTTCCAG GCTTTATATTCTGCTGAGAAGCCAAAGCTGGAAGATGAGCATCTCGTTTTCTTCTGTCAG ATGGGCAAGCGGGGCCTCCAGGCCACGCAGCTGGCCCGGAGTCTTGGATACACTGGGTAC GGGGAGGTGTGGCTGCTAGCTGGGAGG |
Restriction Sites | Please inquire |
ACCN | NM_001113205 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001113205.1, NP_001106676.1 |
RefSeq Size | 688 bp |
RefSeq ORF | 330 bp |
Locus ID | 100131187 |
UniProt ID | Q8NFU3 |
Gene Summary | Thiosulfate:glutathione sulfurtransferase (TST) required to produce S-sulfanylglutathione (GSS(-)), a central intermediate in hydrogen sulfide metabolism (PubMed:24981631). Provides the link between the first step in mammalian H(2)S metabolism performed by the sulfide:quinone oxidoreductase (SQOR) which catalyzes the conversion of H(2)S to thiosulfate, and the sulfur dioxygenase (SDO) which uses GSS(-) as substrate (PubMed:24981631). The thermodynamic coupling of the irreversible SDO and reversible TST reactions provides a model for the physiologically relevant reaction with thiosulfate as the sulfane donor (PubMed:24981631).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region that results in a frameshift and premature stop codon, compared to variant 1. The encoded protein (isoform 3) has a shorter, distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225033 | TSTD1 (Myc-DDK-tagged)-Human thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 (TSTD1), transcript variant 3 |
CNY 1200.00 |
|
RC225033L3 | Lenti-ORF clone of TSTD1 (Myc-DDK-tagged)-Human thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 (TSTD1), transcript variant 3 |
CNY 5890.00 |
|
RC225033L4 | Lenti-ORF clone of TSTD1 (mGFP-tagged)-Human thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 (TSTD1), transcript variant 3 |
CNY 5890.00 |
|
RG225033 | TSTD1 (tGFP-tagged) - Human thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 (TSTD1), transcript variant 3 |
CNY 4370.00 |