TSTD1 (NM_001113205) Human Untagged Clone

CAT#: SC318762

TSTD1 (untagged)-Human thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 (TSTD1), transcript variant 3



  "NM_001113205" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KAT; TST
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001113205, the custom clone sequence may differ by one or more nucleotides
ATGGCTGGAGCGCCCACGGTCTCGCTTCCTGAACTCCGTTCACTCCTAGCCTCCGGACGG
GCCCGGCTCTTCGACGTGCGCTCTCGCGAGGAGGCGGCAGCTGGGACCATCCCAGGGGCG
CTCAACATCCCGGTGTCCGAGTTGGAGAGTGCTCTGCAGATGGAGCCAGCTGCCTTCCAG
GCTTTATATTCTGCTGAGAAGCCAAAGCTGGAAGATGAGCATCTCGTTTTCTTCTGTCAG
ATGGGCAAGCGGGGCCTCCAGGCCACGCAGCTGGCCCGGAGTCTTGGATACACTGGGTAC
GGGGAGGTGTGGCTGCTAGCTGGGAGG
Restriction Sites Please inquire     
ACCN NM_001113205
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001113205.1, NP_001106676.1
RefSeq Size 688 bp
RefSeq ORF 330 bp
Locus ID 100131187
UniProt ID Q8NFU3
Gene Summary Thiosulfate:glutathione sulfurtransferase (TST) required to produce S-sulfanylglutathione (GSS(-)), a central intermediate in hydrogen sulfide metabolism (PubMed:24981631). Provides the link between the first step in mammalian H(2)S metabolism performed by the sulfide:quinone oxidoreductase (SQOR) which catalyzes the conversion of H(2)S to thiosulfate, and the sulfur dioxygenase (SDO) which uses GSS(-) as substrate (PubMed:24981631). The thermodynamic coupling of the irreversible SDO and reversible TST reactions provides a model for the physiologically relevant reaction with thiosulfate as the sulfane donor (PubMed:24981631).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region that results in a frameshift and premature stop codon, compared to variant 1. The encoded protein (isoform 3) has a shorter, distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...