AP2 beta (TFAP2B) (NM_003221) Human Untagged Clone
CAT#: SC317755
TFAP2B (untagged)-Human transcription factor AP-2 beta (activating enhancer binding protein 2 beta) (TFAP2B)
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AP-2B; AP-2beta; AP2-B; PDA2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_003221, the custom clone sequence may differ by one or more nucleotides
ATGCACTCACCTCCTAGAGACCAGGCTGCCATCATGCTCTGGAAGCTTGTGGAGAATGTC AAGTACGAAGATATCTATGAGGACCGGCACGATGGTGTCCCGAGCCACAGCTCGCGGCTC TCCCAGCTGGGCTCGGTGTCCCAAGGACCCTACTCGAGCGCCCCGCCGCTGTCCCACACC CCGTCGTCGGACTTCCAGCCGCCCTACTTCCCACCCCCCTACCAGCCGCTCCCCTACCAC CAGAGCCAGGACCCCTACTCCCACGTCAACGACCCCTACTCCCTGAACCCACTGCACCAG CCCCAGCAACATCCCTGGGGGCAACGGCAGCGGCAAGAAGTGGGTTCGGAAGCCGGCTCT CTCCTGCCCCAGCCTCGGGCCGCCTTGCCCCAGCTCTCGGGCCTTGACCCCCGGAGGGAC TACCACTCGGTCCGCCGGCCGGACGTGCTGCTGCATTCGGCGCACCACGGCCTGGACGCG GGCATGGGTGACAGCCTCTCGCTGCACGGCCTCGGCCATCCCGGAATGGAAGACGTCCAG TCAGTTGAAGATGCCAATAACAGCGGCATGAATCTATTGGACCAGTCTGTCATTAAAAAA GTTCCAGTTCCTCCCAAATCGGTGACTTCTCTAATGATGAATAAAGACGGCTTCCTGGGA GGCATGTCTGTCAACACCGGCGAGGTGTTTTGCTCCGTCCCAGGCCGTTTGTCTCTGCTC AGTTCAACTTCGAAGTACAAAGTAACTGTGGGAGAAGTTCAGAGACGGCTGTCGCCCCCT GAATGCCTCAATGCATCTCTCCTCGGCGGAGTCCTCAGAAGAGCCAAATCGAAAAATGGG GGGAGATCTTTGCGAGAAAGGCTAGAAAAAATCGGTTTGAATTTACCCGCGGGCAGGCGC AAAGCAGCAAATGTCACGTTACTCACCTCCCTGGTGGAAGGAGAAGCTGTTCACTTAGCT AGGGATTTTGGGTACATTTGCGAAACGGAGTTTCCCGCCAAAGCCGTCTCTGAGTATTTG AACCGGCAGCACACAGACCCGAGTGACCTGCACTCCCGAAAGAATATGCTGTTGGCCACC AAGCAACTTTGTAAAGAATTTACGGATCTACTGGCGCAGGACCGGACACCGATAGGGAAC AGCCGACCCAGCCCCATCCTGGAGCCGGGGATCCAGAGCTGCCTCACGCACTTCAGCCTC ATCACGCACGGCTTCGGCGCCCCGGCCATTTGCGCCGCGCTCACGGCCCTGCAGAACTAT CTCACCGAGGCGCTCAAAGGCATGGACAAGATGTTCTTGAACAACACCACCACTAACAGG CACACGTCTGGGGAAGGCCCAGGTAGTAAAACTGGCGACAAGGAGGAGAAACACAGGAAA |
Restriction Sites | Please inquire |
ACCN | NM_003221 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003221.3, NP_003212.2 |
RefSeq Size | 5770 bp |
RefSeq ORF | 1383 bp |
Locus ID | 7021 |
UniProt ID | Q92481 |
Domains | TF_AP-2 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a member of the AP-2 family of transcription factors. AP-2 proteins form homo- or hetero-dimers with other AP-2 family members and bind specific DNA sequences. They are thought to stimulate cell proliferation and suppress terminal differentiation of specific cell types during embryonic development. Specific AP-2 family members differ in their expression patterns and binding affinity for different promoters. This protein functions as both a transcriptional activator and repressor. Mutations in this gene result in autosomal dominant Char syndrome, suggesting that this gene functions in the differentiation of neural crest cell derivatives. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204504 | TFAP2B (Myc-DDK-tagged)-Human transcription factor AP-2 beta (activating enhancer binding protein 2 beta) (TFAP2B) |
CNY 3656.00 |
|
RC204504L1 | Lenti ORF clone of Human transcription factor AP-2 beta (activating enhancer binding protein 2 beta) (TFAP2B), Myc-DDK-tagged |
CNY 6056.00 |
|
RC204504L2 | Lenti ORF clone of Human transcription factor AP-2 beta (activating enhancer binding protein 2 beta) (TFAP2B), mGFP tagged |
CNY 5890.00 |
|
RC204504L3 | Lenti ORF clone of Human transcription factor AP-2 beta (activating enhancer binding protein 2 beta) (TFAP2B), Myc-DDK-tagged |
CNY 6056.00 |
|
RC204504L4 | Lenti ORF clone of Human transcription factor AP-2 beta (activating enhancer binding protein 2 beta) (TFAP2B), mGFP tagged |
CNY 6056.00 |
|
RG204504 | TFAP2B (tGFP-tagged) - Human transcription factor AP-2 beta (activating enhancer binding protein 2 beta) (TFAP2B) |
CNY 5256.00 |
|
SC310374 | TFAP2B (untagged)-Human transcription factor AP-2 beta (activating enhancer binding protein 2 beta) (TFAP2B) |
CNY 7220.00 |
|
SC323940 | TFAP2B (untagged)-Human transcription factor AP-2 beta (activating enhancer binding protein 2 beta) (TFAP2B) |
CNY 3656.00 |
其它AP2 beta产品