SNX6 (NM_152233) Human Untagged Clone
CAT＃: SC317669
SNX6 (untagged)-Human sorting nexin 6 (SNX6), transcript variant 2
CNY 6750.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MSTP010; TFAF2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_152233, the custom clone sequence may differ by one or more nucleotides
ATGCGCGCCTGCGCCGGCCCTCGCCTCGGAGCAGCCATGATGGAAGGCCTGGACGACGGC CCGGACTTCCTCTCAGAAGAGGACCGCGGACTTAAAGCAATAAATGTAGATCTTCAAAGT GATGCTGCTCTGCAGGTGGACATTTCTGATGCTCTTAGTGAGCGGGATAAAGTAAAATTC ACTGTTCACACAAAGAGTTCATTGCCAAATTTTAAACAAAACGAGTTTTCAGTTGTTCGG CAACATGAGGAATTTATCTGGCTTCATGATTCCTTTGTTGAAAATGAAGACTATGCAGGT TATATCATTCCACCAGCACCACCAAGACCTGATTTTGATGCTTCAAGGGAAAAACTACAG AAGCTTGGTGAAGGAGAAGGGTCAATGACGAAGGAAGAATTCACAAAGATGAAACAGGAA CTGGAAGCTGAATATTTGGCAATATTCAAGAAGACAGTTGCGATGCATGAAGTGTTCCTG TGTCGTGTGGCAGCACATCCTATTTTGAGAAGAGATTTAAATTTCCATGTCTTCTTGGAA TATAATCAAGATTTGAGTGTGCGAGGAAAAAATAAAAAAGAGAAACTTGAAGACTTCTTT AAAAACATGGTTAAATCAGCAGATGGAGTAATCGTTTCAGGAGTAAAGGATGTAGATGAT TTCTTTGAGCACGAACGAACATTTCTTTTGGAGTATCATAACCGAGTTAAGGATGCATCT GCTAAATCTGATAGAATGACAAGATCCCACAAAAGTGCTGCAGATGATTACAATAGAATT GGTTCTTCATTATATGCTTTAGGAACTCAGGATTCTACAGATATATGCAAGTTTTTTCTC AAAGTTTCAGAACTGTTCGATAAAACAAGAAAAATAGAAGCACGAGTGTCTGCTGATGAA GACCTCAAACTTTCTGATCTTTTAAAATATTACTTAAGAGAATCTCAAGCTGCTAAGGAT CTCCTGTATCGAAGGTCTAGGTCACTAGTGGATTATGAAAATGCTAATAAAGCACTGGAT AAAGCAAGAGCAAAAAATAAAGATGTTCTACAGGCCGAAACTTCCCAACAATTATGTTGT CAGAAATTTGAAAAAATATCTGAGTCTGCAAAACAAGAACTTATAGATTTTAAGACAAGA AGAGTTGCTGCATTCAGAAAAAATTTAGTGGAACTGGCAGAGTTAGAACTGAAGCATGCA AAGGGTAATCTACAGTTGCTGCAGAACTGCCTGGCAGTGTTAAATGGAGACACA |
| Restriction Sites | Please inquire |
| ACCN | NM_152233 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_152233.2, NP_689419.2 |
| RefSeq Size | 2975 bp |
| RefSeq ORF | 1257 bp |
| Locus ID | 58533 |
| UniProt ID | Q9UNH7 |
| Domains | PX |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS |
| Gene Summary | This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associates with the long isoform of the leptin receptor, the transforming growth factor-beta family of receptor serine-threonine kinases, and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor. This protein may form oligomeric complexes with family member proteins through interactions of both the PX domain and the coiled coil regions of the molecules. Translocation of this protein from the cytoplasm to the nucleus occurs after binding to proviral integration site 1 protein. This gene results in two transcripts encoding two distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) encodes the longest isoform (b). CCDS Note: The coding region has been updated to scale back the N-terminus to one that is more supported by available conservation data. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222458 | SNX6 (Myc-DDK-tagged)-Human sorting nexin 6 (SNX6), transcript variant 2 |
CNY 3656.00 |
|
| RC222458L3 | Lenti-ORF clone of SNX6 (Myc-DDK-tagged)-Human sorting nexin 6 (SNX6), transcript variant 2 |
CNY 5890.00 |
|
| RC222458L4 | Lenti-ORF clone of SNX6 (mGFP-tagged)-Human sorting nexin 6 (SNX6), transcript variant 2 |
CNY 5890.00 |
|
| RG222458 | SNX6 (tGFP-tagged) - Human sorting nexin 6 (SNX6), transcript variant 2 |
CNY 4370.00 |
|
| SC108244 | SNX6 (untagged)-Human sorting nexin 6 (SNX6), transcript variant 2 |
CNY 3656.00 |
