SNX6 (NM_152233) Human Untagged Clone

CAT#: SC317669

SNX6 (untagged)-Human sorting nexin 6 (SNX6), transcript variant 2



  "NM_152233" in other vectors (5)

CNY 6750.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SNX6 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MSTP010; TFAF2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_152233, the custom clone sequence may differ by one or more nucleotides
ATGCGCGCCTGCGCCGGCCCTCGCCTCGGAGCAGCCATGATGGAAGGCCTGGACGACGGC
CCGGACTTCCTCTCAGAAGAGGACCGCGGACTTAAAGCAATAAATGTAGATCTTCAAAGT
GATGCTGCTCTGCAGGTGGACATTTCTGATGCTCTTAGTGAGCGGGATAAAGTAAAATTC
ACTGTTCACACAAAGAGTTCATTGCCAAATTTTAAACAAAACGAGTTTTCAGTTGTTCGG
CAACATGAGGAATTTATCTGGCTTCATGATTCCTTTGTTGAAAATGAAGACTATGCAGGT
TATATCATTCCACCAGCACCACCAAGACCTGATTTTGATGCTTCAAGGGAAAAACTACAG
AAGCTTGGTGAAGGAGAAGGGTCAATGACGAAGGAAGAATTCACAAAGATGAAACAGGAA
CTGGAAGCTGAATATTTGGCAATATTCAAGAAGACAGTTGCGATGCATGAAGTGTTCCTG
TGTCGTGTGGCAGCACATCCTATTTTGAGAAGAGATTTAAATTTCCATGTCTTCTTGGAA
TATAATCAAGATTTGAGTGTGCGAGGAAAAAATAAAAAAGAGAAACTTGAAGACTTCTTT
AAAAACATGGTTAAATCAGCAGATGGAGTAATCGTTTCAGGAGTAAAGGATGTAGATGAT
TTCTTTGAGCACGAACGAACATTTCTTTTGGAGTATCATAACCGAGTTAAGGATGCATCT
GCTAAATCTGATAGAATGACAAGATCCCACAAAAGTGCTGCAGATGATTACAATAGAATT
GGTTCTTCATTATATGCTTTAGGAACTCAGGATTCTACAGATATATGCAAGTTTTTTCTC
AAAGTTTCAGAACTGTTCGATAAAACAAGAAAAATAGAAGCACGAGTGTCTGCTGATGAA
GACCTCAAACTTTCTGATCTTTTAAAATATTACTTAAGAGAATCTCAAGCTGCTAAGGAT
CTCCTGTATCGAAGGTCTAGGTCACTAGTGGATTATGAAAATGCTAATAAAGCACTGGAT
AAAGCAAGAGCAAAAAATAAAGATGTTCTACAGGCCGAAACTTCCCAACAATTATGTTGT
CAGAAATTTGAAAAAATATCTGAGTCTGCAAAACAAGAACTTATAGATTTTAAGACAAGA
AGAGTTGCTGCATTCAGAAAAAATTTAGTGGAACTGGCAGAGTTAGAACTGAAGCATGCA
AAGGGTAATCTACAGTTGCTGCAGAACTGCCTGGCAGTGTTAAATGGAGACACA
Restriction Sites Please inquire     
ACCN NM_152233
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_152233.2, NP_689419.2
RefSeq Size 2975 bp
RefSeq ORF 1257 bp
Locus ID 58533
UniProt ID Q9UNH7
Domains PX
Protein Families Druggable Genome, ES Cell Differentiation/IPS
Gene Summary This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associates with the long isoform of the leptin receptor, the transforming growth factor-beta family of receptor serine-threonine kinases, and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor. This protein may form oligomeric complexes with family member proteins through interactions of both the PX domain and the coiled coil regions of the molecules. Translocation of this protein from the cytoplasm to the nucleus occurs after binding to proviral integration site 1 protein. This gene results in two transcripts encoding two distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) encodes the longest isoform (b). CCDS Note: The coding region has been updated to scale back the N-terminus to one that is more supported by available conservation data.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...