SYT8 (NM_138567) Human Untagged Clone

CAT#: SC317636

SYT8 (untagged)-Human synaptotagmin VIII (SYT8)



  "NM_138567" in other vectors (6)

CNY 6460.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-SYT8 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317636 representing NM_138567.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCCACCTGCATGGCTGGCAAACCATGCAGGGTAGAAAGATGGGGCACCCACCAGTCTCTCCCAGT
GCCCCGGCCCCAGCTGGCACCACAGCTATACCTGGGCTTATTCCAGACCTTGTCGCCGGGACCCCCTGG
CCCCGCTGGGCTCTCATTGCCGGCGCCCTTGCCGCGGGCGTCCTCCTCGTCTCCTGCCTCCTCTGTGCT
GCCTGCTGCTGCTGCCGCCGCCACAGGAAGAAGCCCAGGGACAAGGAGTCCGTGGGTCTGGGCAGTGCC
CGCGGCACCACCACCACCCACCTGGTGCAACCTGATGTGGATGGCCTGGAGTCCAGCCCGGGGGATGCT
CAGCAATGGGGGCGCCTGCAGCTCTCCCTGGAGTTCGACTTTGGAAGCCAGGAGATCAGGGTGGGCCTG
AGGCAGGCAGCCGACCTGAGGCCTGGGGGCACCGTGGACCCCTATGCCCGGGTCAGCGTCTCCACCCAG
GCCGGACACAGACATGAGACAAAAGTGCACCGAGGCACGCTCTGCCCCGTGTTTGACGAGACCTGCTGC
TTCCACATCCCGCAGGCGGAGCTGCCAGGGGCCACCCTGCAGGTGCAGCTTTTCAACTTCAAGCGCTTC
TCGGGGCATGAGCCCCTGGGTGAGCTCCGTCTGCCACTGGGCACCGTGGATCTGCAGCATGTTCTGGAG
CACTGGTACCTGCTGGGCCCGCCGGCTGCCACTCAGCCCGAGCAGGTCGGGGAGCTGTGCTTCTCTCTC
CGGTACGTGCCCAGCTCAGGCCGGCTGACCGTGGTGGTGCTGGAGGCTCGAGGCCTGCGTCCAGGACTT
GCAGAGCCCTACGTGAAGGTCCAGCTCATGCTGAACCAGAGGAAGTGGAAGAAGAGAAAGACAGCCACC
AAAAAGGGCACGGCGGCCCCCTACTTCAATGAGGCCTTCACCTTCCTGGTGCCCTTCAGCCAGGTCCAG
AATGTGGACCTGGTGCTGGCTGTCTGGGACCGCAGCCTGCCGCTCCGAACTGAGCCCGTAGGCAAGGTG
CACCTGGGTGCCCGGGCCTCGGGGCAGCCCCTGCAGCACTGGGCAGACATGCTGGCCCACGCCCGGCGG
CCCATTGCCCAGCGGCACCCCCTGCGGCCAGCCAGGGAGGTGGACCGCATGCTGGCCCTGCAGCCCCGC
CTTCGCCTGCGCCTGCCCTTGCCCCACTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_138567
Insert Size 1206 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_138567.4
RefSeq Size 1558 bp
RefSeq ORF 1206 bp
Locus ID 90019
UniProt ID Q8NBV8
Protein Families Transmembrane
MW 44.2 kDa
Gene Summary This gene encodes a member of the synaptotagmin protein family. Synaptotagmins are membrane proteins that are important in neurotransmission and hormone secretion, both of which involve regulated exocytosis. Expression of the encoded protein in human pancreatic islets has been connected to activity of the promoter for the insulin gene, on the same chromosome several hundred kilobases away (PMID: 21336277 and 22928559). This association would link response to gluclose to insulin secretion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice site, and an alternate upstream translation start, compared to variant 1. The encoded protein (isoform 2) is shorter and has a distinct N-terminus, compared to isoform 1. CCDS Note: The coding region has been updated to represent an alternative 3' splice pattern, resulting in a longer and distinct C-terminus that is better supported by available transcript and homology data. The update adds two C2 domains (Ca2+-dependent membrane-targeting modules), which are hallmarks of synaptotagmin proteins.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...