TCF7 (NM_003202) Human Untagged Clone

CAT#: SC317616

TCF7 (untagged)-Human transcription factor 7 (T-cell specific, HMG-box) (TCF7), transcript variant 1



  "NM_003202" in other vectors (7)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


TCF7 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TCF-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_003202, the custom clone sequence may differ by one or more nucleotides


ATGCCGCAGCTGGACTCCGGCGGGGGCGGCGCGGGCGGCGGCGACGACCTCGGCGCGCCGGACGAGCTGC
TGGCCTTCCAGGATGAAGGCGAGGAGCAGGACGACAAGAGCCGCGACAGCGCCGCCGGTCCCGAGCGCGA
CCTGGCCGAGCTCAAGTCGTCGCTCGTGAACGAGTCCGAGGGCGCGGCCGGCGGCGCAGGGATCCCGGGG
GTCCCGGGGGCCGGCGCCGGGGCCCGCGGCGAGGCCGAGGCTCTCGGGCGGGAACACGCTGCGCAGAGAC
TCTTCCCGGACAAACTTCCAGAGCCCCTGGAGGACGGCCTGAAGGCCCCGGAGTGCACCAGCGGCATGTA
CAAAGAGACCGTCTACTCCGCCTTCAATCTGCTCATGCATTACCCACCCCCCTCGGGAGCAGGGCAGCAC
CCCCAGCCGCAGCCCCCGCTGCACAAGGCCAATCAGCCCCCCCACGGTGTCCCCCAACTCTCTCTCTACG
AACATTTCAACAGCCCACATCCCACCCCTGCACCTGCGGACATCAGCCAGAAGCAAGTTCACAGGCCTCT
GCAGACCCCTGACCTCTCTGGCTTCTACTCCCTGACCTCAGGCAGCATGGGGCAGCTCCCCCACACTGTG
AGCTGGTTCACCCACCCATCCTTGATGCTAGGTTCTGGTGTACCTGGTCACCCAGCAGCCATCCCCCACC
CGGCCATTGTGCCCCCCTCAGGGAAGCAGGAGCTGCAGCCCTTCGACCGCAACCTGAAGACACAAGCAGA
GTCCAAGGCAGAGAAGGAGGCCAAGAAGCCAACCATCAAGAAGCCCCTCAATGCCTTCATGCTGTACATG
AAGGAGATGAGAGCCAAGGTCATTGCAGAGTGCACACTTAAGGAGAGCGCTGCCATCAACCAGATCCTGG
GCCGCAGGTGGCACGCGCTGTCGCGAGAAGAGCAGGCCAAGTACTATGAGCTGGCCCGCAAGGAGAGGCA
GCTGCACATGCAGCTATACCCAGGCTGGTCAGCGCGGGACAACTACGGGAAGAAGAAGAGGCGGTCGAGG
GAAAAGCACCAAGAATCCACCACAGGAGGAAAAAGAAATGCATTCGGTACTTACCCGGAGAAGGCCGCTG
CCCCAGCCCCGTTCCTTCCGATGACAGTGCTCTAG


Restriction Sites Please inquire     
ACCN NM_003202
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003202.2, NP_003193.2
RefSeq Size 3283 bp
RefSeq ORF 1155 bp
Locus ID 6932
UniProt ID P36402
Domains HMG
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway
Gene Summary This gene encodes a member of the T-cell factor/lymphoid enhancer-binding factor family of high mobility group (HMG) box transcriptional activators. This gene is expressed predominantly in T-cells and plays a critical role in natural killer cell and innate lymphoid cell development. The encoded protein forms a complex with beta-catenin and activates transcription through a Wnt/beta-catenin signaling pathway. Mice with a knockout of this gene are viable and fertile, but display a block in T-lymphocyte differentiation. Alternative splicing results in multiple transcript variants. Naturally-occurring isoforms lacking the N-terminal beta-catenin interaction domain may act as dominant negative regulators of Wnt signaling. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (1) encodes isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...