NKX2.3 (NKX2-3) (NM_145285) Human Untagged Clone
CAT#: SC317582
NKX2 (untagged)-Human NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3)
CNY 5488.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CSX3; NK2.3; NKX2.3; NKX2C; NKX4-3 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene ORF sequence for NM_145285 edited
ATGATGTTACCAAGCCCGGTCACCTCCACCCCTTTCTCAGTCAAAGACATTTTGAATCTG GAGCAGCAGCACCAGCACTTCCATGGTGCGCACTTGCAGGCGGACTTGGAGCACCACTTC CACTCTGCGCCCTGCATGCTGGCCGCCGCTGAGGGGACGCAATTTTCTGACGGAGGGGAG GAGGACGAGGAAGACGAGGGCGAGAAATTGTCCTATTTGAACTCACTAGCCGCAGCAGAC GGCCACGGGGATTCAGGGCTGTGTCCCCAGGGCTATGTCCACACGGTCCTGCGAGACTCG TGCAGCGAGCCCAAGGAACATGAAGAGGAGCCCGAGGTCGTGAGGGACCGGAGCCAAAAA AGCTGCCAGCTGAAGAAGTCTCTAGAGACGGCCGGAGACTGCAAGGCGGCGGAGGAGAGC GAGAGGCCGAAGCCACGCAGCCGCCGGAAGCCCCGGGTCCTCTTCTCGCAAGCCCAGGTC TTCGAGCTGGAACGCAGGTTCAAGCAGCAGCGGTACCTGTCGGCACCCGAGCGCGAGCAC CTCGCCAGCAGCCTGAAGCTCACATCCACTCAGGTGAAAATCTGGTTCCAGAATCGCAGG TACAAGTGCAAGAGACAGCGGCAGGACAAGTCTCTGGAGCTTGGCGCACACGCGCCCCCG CCGCCGCCGCGCCGCGTGGCTGTCCCGGTGCTGGTGCGGGACGGCAAGCCGTGCGTCACG CCCAGCGCGCAGGCCTACGGCGCGCCCTACAGCGTGGGCGCCAGCGCCTACTCCTACAAC AGCTTCCCCGCCTACGGCTATGGGAACTCGGCCGCGGCCGCCGCCGCCGCCGCCGCCGCC GCCGCAGCAGCGGCGGCCTACAGCAGCAGCTATGGCTGTGCGTACCCGGCGGGCGGCGGC GGCGGCGGCGGCGGGACCTCCGCGGCGACCACTGCCATGCAGCCCGCCTGCAGCGCGGCC GGAGGCGGCCCCTTTGTGAACGTGAGCAACCTAGGAGGCTTCGGCAGCGGCGGCAGCGCA CAGCCGTTGCACCAGGGTACTGCAGCCGGGGCCGCGTGCGCTCAGGGCACCTTGCAGGGC ATCCGGGCCTGGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_145285 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_145285.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145285.2, NP_660328.2 |
| RefSeq Size | 2117 bp |
| RefSeq ORF | 1095 bp |
| Locus ID | 159296 |
| UniProt ID | Q8TAU0 |
| Domains | homeobox |
| Protein Families | Transcription Factors |
| Gene Summary | This gene encodes a homeodomain-containing transcription factor. The encoded protein is a member of the NKX family of homeodomain transcription factors. Studies of similar proteins in mouse and rat have indicated a potential role in cellular differentiation.[provided by RefSeq, Mar 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC206667 | NKX2 (Myc-DDK-tagged)-Human NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3) |
CNY 5488.00 |
|
| RC206667L1 | Lenti ORF clone of Human NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3), Myc-DDK-tagged |
CNY 7888.00 |
|
| RC206667L2 | Lenti ORF clone of Human NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3), mGFP tagged |
CNY 5890.00 |
|
| RC206667L3 | Lenti ORF clone of Human NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3), Myc-DDK-tagged |
CNY 7888.00 |
|
| RC206667L4 | Lenti ORF clone of Human NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3), mGFP tagged |
CNY 5890.00 |
|
| RG206667 | NKX2 (tGFP-tagged) - Human NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3) |
CNY 7088.00 |
|
| SC108072 | NKX2 (untagged)-Human NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3) |
CNY 3600.00 |
