HOXD13 (NM_000523) Human Untagged Clone
CAT#: SC317533
HOXD13 (untagged)-Human homeobox D13 (HOXD13)
CNY 3656.00
CNY 5610.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BDE; BDSD; HOX4I; SPD; SPD1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_000523 edited
ATGAGCCGCGCCGGGAGCTGGGACATGGACGGGCTGCGGGCAGACGGCGGGGGCGCCGGT GGCGCCCCGGCCTCTTCCTCCTCCTCATCGGTGGCGGCGGCGGCGGCGTCAGGCCAGTGC CGCGGCTTTCTCTCCGCGCCTGTGTTCGCCGGGACGCATTCGGGGCGGGCGGCGGCGGCG GCAGCGGCGGCTGCGGCGGCGGCGGCGGCAGCCTCCGGCTTTGCGTACCCCGGGACCTCT GAGCGCACGGGCTCTTCCTCGTCGTCGTCCTCTTCTGCCGTTGTAGCGGCGCGCCCGGAG GCTCCCCCAGCCAAAGAGTGCCCAGCACCCACGCCTGCAGCGGCCGCTGCAGCGCCCCCG AGCGCTCCAGCGCTGGGCTACGGCTACCACTTCGGCAACGGCTACTACAGCTGCCGTATG TCGCACGGCGTGGGCTTACAGCAGAATGCGCTCAAGTCATCGCCGCACGCCTCGCTGGGA GGCTTTCCCGTGGAGAAGTACATGGACGTGTCAGGCCTGGCGAGCAGCAGCGTACCGGCC AACGAGGTGCCAGCGCGAGCCAAGGAGGTATCCTTCTACCAGGGCTATACGAGCCCTTAC CAGCACGTGCCCGGCTATATCGACATGGTGTCCACTTTCGGCTCCGGGGAGCCTCGGCAC GAGGCCTACATCTCCATGGAGGGGTACCAGTCCTGGACGCTGGCTAACGGGTGGAACAGC CAGGTGTACTGCACCAAGGACCAGCCACAGGGGTCCCACTTTTGGAAATCTTCCTTTCCA GGGGATGTGGCTCTAAATCAGCCGGACATGTGCGTCTACCGAAGAGGGAGGAAGAAGAGA GTGCCTTACACCAAACTGCAGCTTAAAGAACTGGAGAACGAGTATGCCATTAACAAATTC ATTAACAAGGACAAGCGGCGGCGTATCTCGGCTGCTACGAACCTATCTGAGAGACAAGTG ACCATTTGGTTTCAGAACCGAAGAGTGAAGGACAAGAAAATTGTCTCCAAGCTCAAAGAT ACTGTCTCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_000523 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000523.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000523.3, NP_000514.2 |
RefSeq Size | 2341 bp |
RefSeq ORF | 1032 bp |
Locus ID | 3239 |
UniProt ID | P35453 |
Protein Families | Druggable Genome |
Gene Summary | This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214416 | HOXD13 (Myc-DDK-tagged)-Human homeobox D13 (HOXD13) |
CNY 3656.00 |
|
RC214416L1 | Lenti ORF clone of Human homeobox D13 (HOXD13), Myc-DDK-tagged |
CNY 6056.00 |
|
RC214416L2 | Lenti ORF clone of Human homeobox D13 (HOXD13), mGFP tagged |
CNY 5890.00 |
|
RC214416L3 | Lenti ORF clone of Human homeobox D13 (HOXD13), Myc-DDK-tagged |
CNY 6056.00 |
|
RC214416L4 | Lenti ORF clone of Human homeobox D13 (HOXD13), mGFP tagged |
CNY 5890.00 |
|
RG214416 | HOXD13 (tGFP-tagged) - Human homeobox D13 (HOXD13) |
CNY 4370.00 |
|
SC300089 | HOXD13 (untagged)-Human homeobox D13 (HOXD13) |
CNY 5610.00 |