RAET1G (NM_001001788) Human Untagged Clone

CAT#: SC317509

RAET1G (untagged)-Human retinoic acid early transcript 1G (RAET1G)



  "NM_001001788" in other vectors (6)

CNY 3656.00

CNY 5420.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-RAET1G Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ULBP5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317509 representing NM_001001788.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGCGGCCGCCAGCCCCGCGTTCCTTCTACGCCTCCCGCTTCTGCTCCTGCTGTCCAGCTGGTGC
AGGACCGGGCTGGCCGACCCTCACTCTCTTTGCTATGACATCACCGTCATCCCTAAGTTCAGACCTGGA
CCACGGTGGTGTGCGGTTCAAGGCCAGGTGGATGAAAAGACTTTTCTTCACTATGACTGTGGCAGCAAG
ACAGTCACACCCGTCAGTCCCCTGGGGAAGAAACTAAATGTCACAACGGCCTGGAAAGCACAGAACCCA
GTACTGAGAGAGGTGGTGGACATACTTACAGAGCAACTGCTTGACATTCAGCTGGAGAATTACATACCC
AAGGAACCCCTCACCCTGCAGGCCAGGATGTCTTGTGAGCAGAAAGCCGAAGGACACGGCAGTGGATCT
TGGCAGCTCAGTTTCGATGGACAGATCTTCCTCCTCTTTGACTCAGAAAACAGAATGTGGACAACGGTT
CATCCTGGAGCCAGAAAGATGAAAGAAAAGTGGGAGAATGACAAGGATATGACCATGTCCTTCCATTAC
ATCTCAATGGGAGACTGCACAGGATGGCTTGAGGACTTCTTGATGGGCATGGACAGCACCCTGGAGCCA
AGTGCAGGAGCACCACCCACCATGTCCTCAGGCACAGCCCAACCCAGGGCCACGGCCACCACCCTCATC
CTTTGCTGCCTCCTCATCATGTGTCTCCTCATATGCTCCAGGCACAGTCTGACCCAAAGCCATGGCCAC
CACCCTCAGTCCCTGCAGCCTCCTCCTCATCCTCCCCTGCTTCATCCTACCTGGCTGCTGAGAAGAGTC
CTTTGGAGTGACAGCTACCAAATAGCGAAGCGCCCCTTGTCTGGTGGACACGTGACTCGCGTGACTTTA
CCTATCATTGGAGACGACTCACACTCCTTACCCTGCCCTCTTGCCTTGTATACAATAAATAACGGCGCA
GCCAGGTATTCGGAGCCACTACAGGTCTCCATATCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001001788
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001001788.2
RefSeq Size 1144 bp
RefSeq ORF 1005 bp
Locus ID 353091
UniProt ID Q6H3X3
Protein Families Druggable Genome
Protein Pathways Natural killer cell mediated cytotoxicity
MW 37.1 kDa
Gene Summary This gene encodes a member of the major histocompatibility complex (MHC) class I family of proteins. Although the encoded protein includes C-terminal transmembrane and cytoplasmic domains, proteolytic processing results in the removal of these domains and subsequent tethering to the plasma membrane by a glycosylphosphatidylinositol (GPI)-anchor. The encoded protein is one of several related ligands of the natural killer group 2, member D (NKG2D) receptor, which functions as an activating receptor in innate and adaptive immunity. This gene is present in a gene cluster on chromosome 6. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (1, also known as RAET1G1) represents the longer transcript and encodes the protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...