OTUD6B (NM_016023) Human Untagged Clone
CAT#: SC317493
OTUD6B (untagged)-Human OTU domain containing 6B (OTUD6B)
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CGI-77; DUBA-5; DUBA5; IDDFSDA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317493 representing NM_016023.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGCCCCGGGTGAGGGTTGAGGGGTGGAAGGTGCCTACTAGCCGGTGCAGGTTTCTTCTAGCGCGT GTGCTGGGGTACCTGGTCGTCATGGAGGCGGTATTGACCGAAGAGCTTGATGAGGAAGAGCAGCTGCTG AGAAGGCATCGCAAAGAGAAGAAGGAGTTGCAAGCCAAAATTCAGGGCATGAAGAATGCTGTTCCCAAG AATGACAAGAAGAGGAGGAAGCAACTCACCGAAGATGTGGCCAAGTTGGAAAAAGAAATGGAACAGAAA CATAGAGAGGAACTGGAGCAATTGAAGCTGACTACTAAGGAGAATAAGATAGATTCTGTTGCTGTTAAC ATTTCAAACTTGGTGCTTGAGAATCAGCCACCTCGGATATCAAAAGCACAAAAGAGACGGGAAAAGAAA GCTGCATTGGAAAAGGAGCGAGAAGAACGGATAGCTGAAGCTGAAATTGAAAACTTAACAGGAGCCAGA CATATGGAAAGTGAGAAACTTGCTCAAATATTGGCAGCTAGACAGTTAGAAATTAAACAGATTCCATCT GATGGCCACTGTATGTATAAAGCCATTGAAGATCAACTGAAAGAAAAGGATTGTGCTCTGACTGTGGTT GCCTTGAGAAGTCAGACCGCTGAGTATATGCAAAGCCATGTGGAAGACTTTCTGCCATTTTTAACAAAC CCTAATACAGGAGATATGTATACTCCAGAAGAATTTCAGAAGTACTGTGAAGATATTGTAAACACAGCT GCATGGGGAGGTCAGCTTGAGCTAAGAGCTCTGTCTCACATTTTACAAACACCAATAGAGATAATACAG GCAGATTCTCCTCCCATTATAGTTGGTGAAGAATATTCAAAAAAACCACTAATACTTGTATATATGAGA CATGCATATGGCTTAGGAGAACATTATAATTCGGTTACACGGTTGGTAAACATAGTTACTGAAAATTGC AGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_016023 |
Insert Size | 972 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016023.3 |
RefSeq Size | 3306 bp |
RefSeq ORF | 972 bp |
Locus ID | 51633 |
UniProt ID | Q8N6M0 |
Domains | OTU |
Protein Families | Protease |
MW | 37.3 kDa |
Gene Summary | This gene encodes a member of the ovarian tumor domain (OTU)-containing subfamily of deubiquitinating enzymes. Deubiquitinating enzymes are primarily involved in removing ubiquitin from proteins targeted for degradation. This protein may function as a negative regulator of the cell cycle in B cells. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (1) encodes the longer isoform (1). CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203722 | OTUD6B (Myc-DDK-tagged)-Human OTU domain containing 6B (OTUD6B) |
CNY 3600.00 |
|
RC203722L1 | Lenti ORF clone of Human OTU domain containing 6B (OTUD6B), Myc-DDK-tagged |
CNY 6000.00 |
|
RC203722L2 | Lenti ORF clone of Human OTU domain containing 6B (OTUD6B), mGFP tagged |
CNY 5890.00 |
|
RC203722L3 | Lenti ORF clone of Human OTU domain containing 6B (OTUD6B), Myc-DDK-tagged |
CNY 5890.00 |
|
RC203722L4 | Lenti ORF clone of Human OTU domain containing 6B (OTUD6B), mGFP tagged |
CNY 5890.00 |
|
RG203722 | OTUD6B (tGFP-tagged) - Human OTU domain containing 6B (OTUD6B) |
CNY 5200.00 |
|
SC125375 | OTUD6B (untagged)-Human OTU domain containing 6B (OTUD6B) |
CNY 3600.00 |
|
SC317494 | OTUD6B (untagged)-Human OTU domain containing 6B (OTUD6B) |
CNY 3600.00 |
|
SC322515 | OTUD6B (untagged)-Human OTU domain containing 6B (OTUD6B) |
CNY 3600.00 |