DUOXA2 (NM_207581) Human Untagged Clone
CAT#: SC317488
DUOXA2 (untagged)-Human dual oxidase maturation factor 2 (DUOXA2)
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SIMNIPHOM; TDH5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_207581 edited
ATGACCCTGTGGAACGGCGTACTGCCTTTTTACCCCCAGCCCCGGCATGCCGCAGGCTTC AGCGTTCCACTGCTCATCGTTATTCTAGTGTTTTTGGCTCTAGCAGCAAGCTTCCTGCTC ATCTTGCCGGGGATCCGTGGCCACTCGCGCTGGTTTTGGTTGGTGAGAGTTCTTCTCAGT CTGTTCATAGGCGCAGAAATTGTGGCTGTGCACTTCAGTGCAGAATGGTTCGTGGGTACA GTGAACACCAACACATCCTACAAAGCCTTCAGCGCAGCGCGCGTTACAGCCCGTGTCCGT CTGCTCGTGGGCCTGGAGGGCATTAATATTACACTCACAGGGACCCCAGTGCATCAGCTG AACGAGACCATTGACTACAACGAGCAGTTCACCTGGCGTCTGAAAGAGAATTACGCCGCG GAGTACGCGAACGCACTGGAGAAGGGGCTGCCGGACCCAGTGCTCTACCTGGCGGAGAAG TTCACACCGAGTAGCCCTTGCGGCCTGTACCACCAGTACCACCTGGCGGGACACTACGCC TCGGCCACGCTATGGGTGGCGTTCTGCTTCTGGCTCCTCTCCAACGTGCTGCTCTCCACG CCGGCCCCGCTCTACGGAGGCCTGGCACTGCTGACCACCGGAGCCTTCGCGCTCTTCGGG GTCTTCGCCTTGGCCTCCATCTCTAGCGTGCCGCTCTGCCCGCTCCGCCTAGGCTCCTCC GCGCTCACCACTCAGTACGGCGCCGCCTTCTGGGTCACGCTGGCAACCGGCGTCCTGTGC CTCTTCCTCGGAGGGGCCGTGGTGAGTCTCCAGTATGTTCGGCCCAGCGCTCTTCGCACC CTTCTGGACCAAAGCGCCAAGGACTGCAGCCAGGAGAGAGGGGGCTCACCTCTTATCCTC GGCGACCCACTGCACAAGCAGGCCGCTCTCCCAGACTTAAAATGTATCACCACTAACCTG TGA |
Restriction Sites | Please inquire |
ACCN | NM_207581 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_207581.2, NP_997464.2 |
RefSeq Size | 1440 bp |
RefSeq ORF | 963 bp |
Locus ID | 405753 |
UniProt ID | Q1HG44 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes an endoplasmic reticulum protein that is necessary for proper cellular localization and maturation of functional dual oxidase 2. Mutations in this gene have been associated with thyroid dyshormonogenesis 5.[provided by RefSeq, Feb 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218541 | DUOXA2 (Myc-DDK-tagged)-Human dual oxidase maturation factor 2 (DUOXA2) |
CNY 2400.00 |
|
RC218541L1 | Lenti ORF clone of Human dual oxidase maturation factor 2 (DUOXA2), Myc-DDK-tagged |
CNY 4800.00 |
|
RC218541L2 | Lenti ORF clone of Human dual oxidase maturation factor 2 (DUOXA2), mGFP tagged |
CNY 5890.00 |
|
RC218541L3 | Lenti ORF clone of Human dual oxidase maturation factor 2 (DUOXA2), Myc-DDK-tagged |
CNY 5890.00 |
|
RC218541L4 | Lenti ORF clone of Human dual oxidase maturation factor 2 (DUOXA2), mGFP tagged |
CNY 5890.00 |
|
RG218541 | DUOXA2 (tGFP-tagged) - Human dual oxidase maturation factor 2 (DUOXA2) |
CNY 4370.00 |