GIMAP6 (NM_024711) Human Untagged Clone

CAT#: SC317425

GIMAP6 (untagged)-Human GTPase, IMAP family member 6 (GIMAP6), transcript variant 1



  "NM_024711" in other vectors (5)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-GIMAP6 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IAN-2; IAN-6; IAN2; IAN6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_024711, the custom clone sequence may differ by one or more nucleotides
ATGGAGGAAGAAGAATATGAACAAATTCCCCAGGAGAATCCCCCAGAAGAGCTGTCCCAG
GATCCTGTGCTGGAGCTGTCAGGAGGTCTAAGGGAGAAAGAACAGAAGACCCCAAGGAGA
CTGAGGCTCATTCTCATGGGGAAAACAGGGAGTGGGAAGAGTGCAACAGGAAACAGCATC
CTCGGCAGGGACGTCTTCGAGTCTAAACTCAGCACCAGACCCGTGACCAAGACCTCCCAG
AGACGGAGCCGAGAGTGGGCTGGGAAGGAGCTTGAGGTGATTGACACACCCAACATTCTG
TCCCCCCAGGTCTCGCCAGAGGTGGCAGACGCTATCTGCCAAGCCATCGTCTTATCCGCC
CCAGGGCCCCACGCCGTGCTCCTGGTGACACAACTGGGCCGGTTCACGGATGAGGATCAG
CAGGTGGTCAGGCGCCTGCAGGAGGTCTTTGGAGTGGGGGTTCTGGGTCACACCATCCTG
GTGTTCACCCGGAAGGAAGACCTGGCTGGCGGCTCCCTGGAAGACTATGTGCGAGAGACC
AACAACCAGGCCCTTGCCTGGCTGGATGTGACCCTTGCACGGCGCCATTGCGGCTTCAAC
AACAGGGCACAGGGGGAGGAGCAGGAGGCCCAACTGCGAGAGCTCATGGAGAAAGTTGAA
GCCATTATGTGGGAAAACGAAGGAGATTATTACAGCAACAAGGCTTACCAATATACCCAG
CAAAACTTTCGGCTGAAAGAACTACAGGAAAGGCAAGTAAGCCAGGGCCAAGGCTCTGAG
GACGTGCCTGGTGAGGAGTCTTGGCTGGAAGGACTGTCCCAGATCCAGAAGGAATCTGAG
GAAGCCCACAGATGCCTGCTGGGGAAGGCTGACCTT
Restriction Sites Please inquire     
ACCN NM_024711
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_024711.3, NP_078987.3
RefSeq Size 3422 bp
RefSeq ORF 879 bp
Locus ID 474344
UniProt ID Q6P9H5
Domains AIG1
Gene Summary This gene encodes a member of the GTPases of immunity-associated proteins (GIMAP) family. GIMAP proteins contain GTP-binding and coiled-coil motifs, and may play roles in the regulation of cell survival. Decreased expression of this gene may play a role in non-small cell lung cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, which is found in a cluster with seven additional GIMAP genes on the long arm of chromosome 7. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (1) encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...