SLC6A15 (NM_018057) Human Untagged Clone

CAT#: SC317420

SLC6A15 (untagged)-Human solute carrier family 6 (neutral amino acid transporter), member 15 (SLC6A15), transcript variant 2



  "NM_018057" in other vectors (5)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-SLC6A15 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hv7-3; NTT73; SBAT1; V7-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317420 representing NM_018057.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCAAAAATAGCAAGGTGGTAAAAAGAGAATTAGATGATGATGTTACTGAGTCTGTCAAAGACCTT
CTTTCCAATGAAGACGCAGCTGATGATGCTTTTAAGACAAGTGAACTAATTGTTGATGGCCAGGAAGAG
AAAGATACAGATGTTGAAGAAGGATCTGAAGTCGAAGATGAAAGACCAGCTTGGAACAGTAAACTACAA
TACATCCTGGCCCAAGTTGGATTTTCTGTAGGTTTAGGAAATGTGTGGCGATTTCCATACCTATGTCAG
AAGAATGGGGGCGGTGCATATCTTTTACCATATTTAATACTACTTATGGTAATAGGTATTCCCCTTTTT
TTCTTGGAACTCTCTGTGGGTCAAAGAATTCGGCGAGGCAGCATTGGTGTATGGAATTACATAAGCCCT
AAACTGGGCGGGATTGGATTTGCAAGTTGTGTAGTGTGCTATTTTGTAGCTCTCTACTACAACGTCATC
ATTGGCTGGAGTTTGTTTTATTTTTCTCAGTCTTTTCAGCAACCCCTGCCTTGGGATCAGTGTCCTTTG
GTGAAAAATGCTTCACACACTTTTGTAGAACCAGAATGTGAACAAAGTTCTGCCACCACCTATTACTGG
TACAGGGAAGCACTGAATATTTCAAGTTCCATTTCTGAAAGTGGGGGCTTAAACTGGAAGATGACCATC
TGCTTGTTGGCTGCCTGGGTCATGGTTTGCTTGGCTATGATCAAAGGCATTCAGTCTTCTGGAAAAGTT
AGTATGTTAGAGCCCTTCCTCATTCTGCTAATCACCATTTCTGGATTCATCCCTCTCTCAAATTCTGTT
ACAGATTTCTGTGGGCAAATCACACATAACACTTCATTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_018057
Insert Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_018057.6
RefSeq Size 4276 bp
RefSeq ORF 870 bp
Locus ID 55117
UniProt ID Q9H2J7
Domains SNF
Protein Families Druggable Genome, Transmembrane
MW 32.3 kDa
Gene Summary This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...