ODAM (NM_017855) Human Untagged Clone
CAT#: SC317399
ODAM (untagged)-Human odontogenic, ameloblast asssociated (ODAM)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APIN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_017855, the custom clone sequence may differ by one or more nucleotides
ATGAAAATTATAATTCTTCTTGGATTCCTGGGAGCCACATTGTCAGCCCCACTTATCCCA CAGCGTCTCATGTCTGCCAGCAATAGCAATGAGTTACTTCTTAATCTTAATAATGGTCAA CTTTTGCCACTACAACTTCAGGGCCCACTTAATTCATGGATTCCACCTTTCTCTGGAATT TTACAACAGCAGCAGCAGGCTCAAATTCCAGGACTCTCCCAGTTCTCTTTATCAGCTCTA GACCAGTTTGCTGGACTGCTCCCAAATCAGATACCCTTAACAGGAGAGGCCAGTTTTGCC CAAGGAGCCCAGGCAGGCCAAGTTGATCCCTTACAGCTTCAAACACCGCCTCAGACACAA CCAGGCCCCAGTCACGTGATGCCCTATGTATTCTCCTTCAAAATGCCTCAAGAGCAAGGA CAGATGTTTCAATACTATCCAGTTTACATGGTCCTACCCTGGGAACAACCTCAGCAAACA GTTCCAAGGTCACCTCAACAAACAAGACAGCAACAGTATGAGGAGCAGATACCATTCTAT GCTCAATTTGGATACATTCCACAACTAGCAGAACCTGCTATATCAGGAGGACAGCAGCAA CTAGCTTTTGATCCCCAACTAGGCACAGCTCCTGAAATTGCTGTGATGTCAACAGGAGAA GAGATACCATATTTACAAAAAGAAGCGATCAACTTTAGACATGACAGTGCAGGAGTTTTC ATGCCCTCAACTTCACCAAAACCCAGCACAACCAATGTTTTCACTTCTGCTGTAGACCAA ACTATTACCCCAGAGCTCCCAGAAGAGAAGGACAAGACTGACAGCCTAAGGGAACCA |
Restriction Sites | Please inquire |
ACCN | NM_017855 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_017855.3, NP_060325.3 |
RefSeq Size | 1301 bp |
RefSeq ORF | 840 bp |
Locus ID | 54959 |
UniProt ID | A1E959 |
Gene Summary | Tooth-associated epithelia protein that probably plays a role in odontogenesis, the complex process that results in the initiation and generation of the tooth. May be incorporated in the enamel matrix at the end of mineralization process. Involved in the induction of RHOA activity via interaction with ARHGEF and expression of downstream factors such as ROCK. Plays a role in attachment of the junctional epithelium to the tooth surface.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218743 | ODAM (Myc-DDK-tagged)-Human odontogenic, ameloblast asssociated (ODAM) |
CNY 3600.00 |
|
RC218743L1 | Lenti ORF clone of Human odontogenic, ameloblast asssociated (ODAM), Myc-DDK-tagged |
CNY 6000.00 |
|
RC218743L2 | Lenti ORF clone of Human odontogenic, ameloblast asssociated (ODAM), mGFP tagged |
CNY 5890.00 |
|
RC218743L3 | Lenti ORF clone of Human odontogenic, ameloblast asssociated (ODAM), Myc-DDK-tagged |
CNY 6000.00 |
|
RC218743L4 | Lenti ORF clone of Human odontogenic, ameloblast asssociated (ODAM), mGFP tagged |
CNY 5890.00 |
|
RG218743 | ODAM (tGFP-tagged) - Human odontogenic, ameloblast asssociated (ODAM) |
CNY 4370.00 |
|
SC125928 | ODAM (untagged)-Human odontogenic, ameloblast asssociated (ODAM) |
CNY 1800.00 |