Kallikrein 14 (KLK14) (NM_022046) Human Untagged Clone

CAT#: SC317386

KLK14 (untagged)-Human kallikrein-related peptidase 14 (KLK14)



  "NM_022046" in other vectors (7)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (3)
Rabbit Polyclonal Anti-KLK14 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KLK-L6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317386 representing NM_022046.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCCTGAGGGTCTTGGGCTCTGGGACCTGGCCCTCAGCCCCTAAAATGTTCCTCCTGCTGACAGCA
CTTCAAGTCCTGGCTATAGCCATGACACAGAGCCAAGAGGATGAGAACAAGATAATTGGTGGCCATACG
TGCACCCGGAGCTCCCAGCCGTGGCAGGCGGCCCTGCTGGCGGGTCCCAGGCGCCGCTTCCTCTGCGGA
GGCGCCCTGCTTTCAGGCCAGTGGGTCATCACTGCTGCTCACTGCGGCCGCCCGATCCTTCAGGTTGCC
CTGGGCAAGCACAACCTGAGGAGGTGGGAGGCCACCCAGCAGGTGCTGCGCGTGGTTCGTCAGGTGACG
CACCCCAACTACAACTCCCGGACCCACGACAACGACCTCATGCTGCTGCAGCTACAGCAGCCCGCACGG
ATCGGGAGGGCAGTCAGGCCCATTGAGGTCACCCAGGCCTGTGCCAGCCCCGGGACCTCCTGCCGAGTG
TCAGGCTGGGGAACTATATCCAGCCCCATCGCCAGGTACCCCGCCTCTCTGCAATGCGTGAACATCAAC
ATCTCCCCGGATGAGGTGTGCCAGAAGGCCTATCCTAGAACCATCACGCCTGGCATGGTCTGTGCAGGA
GTTCCCCAGGGCGGGAAGGACTCTTGTCAGGGTGACTCTGGGGGACCCCTGGTGTGCAGAGGACAGCTC
CAGGGCCTCGTGTCTTGGGGAATGGAGCGCTGCGCCCTGCCTGGCTACCCCGGTGTCTACACCAACCTG
TGCAAGTACAGAAGCTGGATTGAGGAAACGATGCGGGACAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_022046
Insert Size 804 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022046.5
RefSeq Size 1022 bp
RefSeq ORF 804 bp
Locus ID 43847
UniProt ID Q9P0G3
Protein Families Druggable Genome, Protease, Secreted Protein
MW 29.1 kDa
Gene Summary This gene encodes a member of the kallikrein subfamily of serine proteases that have diverse physiological functions such as regulation of blood pressure and desquamation. The altered expression of this gene is implicated in the progression of different cancers including breast and prostate tumors. The encoded protein is a precursor that is proteolytically processed to generate the functional enzyme. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1-3 all encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...