CMTM1 (NM_181268) Human Untagged Clone

CAT#: SC317334

CMTM1 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 18



  "NM_181268" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-CMTM1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CKLFH; CKLFH1; CKLFSF1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317334 representing NM_181268.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATCCTGAACACGCCAAACCTGAGTCATCCGAGGCACCTTCAGGGAACTTGAAACAACCGGAGACT
GCCGCAGCCCTGGCAAGTAGCGGCAGCGTAGTGAGTTCTGTACCCAAGGCACAGCGCAACATCTCAGCG
AAGACCGCACCCCGGAAGCACCCCGCAGTCTCAATTCGCAGTGCGCAGTCCGCAGCCGCCGCACGTCCC
CAAGGCAGTGAGGGCACCGCACCCTCAAGGAAAGCCACCACACGCCCACCCCCAAAGCCCACACTCCCA
CCCCCCACGCCCTCTGCACACACTGAATCCAAACTCTTAAATGAGATGGCGATCAAAGAGCGCGTGGAG
GGCCGAGCCAAAGTCCCGTACAAATTCAGGGACAGCCTCAAACGTTTCTCCTTCTCGCCCACTGGAATG
TTGAAGATCCTGAGACTGAGTCTTATCTTAGGAGCATTAGCTTGTTTCATCATCACCCAAGCCAATGAG
TCATTTATAACAATCACAAGTCTGGAAATCTGCATTGTCGTTTTTTTTATTCTAATATATGTGCTAACC
CTTCACCACTTGCTGACCTATTTACATTGGCCCTTACTTGATCTTACCAACAGTATCATTACAGCTGTG
TTCCTTTCAGTAGTTGCCATCTTGGCCATGCAAGAAAAGAAAAGAAGGCATTTACTCTATGTCGGGGGG
CGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_181268
Insert Size 696 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181268.2
RefSeq Size 1065 bp
RefSeq ORF 696 bp
Locus ID 113540
UniProt ID Q8IZ96
Protein Families Transmembrane
MW 25.1 kDa
Gene Summary This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CKLF (chemokine-like factor).[provided by RefSeq, Feb 2011]
Transcript Variant: This variant (18) lacks an exon segment, compared to variant 17, which results in a translational frameshift in the last coding exon. The encoded isoform (14) is shorter and contains a distinct C-terminus, compared to the protein (isoform 13) encoded by variant 17.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...