TMEM97 (NM_014573) Human Untagged Clone
CAT#: SC317273
TMEM97 (untagged)-Human transmembrane protein 97 (TMEM97)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MAC30 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_014573 edited
ATGGGGGCTCCGGCAACCAGGCGCTGCGTGGAGTGGCTGCTGGGCCTCTACTTCCTCAGC CACATCCCCATCACCCTGTTCATGGACCTGCAGGCGGTGCTGCCGCGCGAGCTCTACCCA GTCGAGTTTAGAAACCTGCTGAAGTGGTATGCTAAGGAGTTCAAAGACCCACTGCTACAG GAGCCCCCAGCCTGGTTTAAGTCCTTTCTGTTTTGCGAGCTTGTGTTTCAGCTGCCTTTC TTTCCCATTGCAACGTATGCCTTCCTCAAAGGAAGCTGCAAGTGGATTCGAACTCCTGCA ATCATCTACTCTGTTCACACCATGACAACCTTAATTCCGATACTCTCCACATTTCTGTTT GAGGATTTCTCCAAAGCCAGTGGTTTCAAGGGACAAAGACCTGAGACTTTGCATGAACGG TTAACCCTTGTGTCTGTCTATGCCCCCTACTTACTCATCCCATTCATACTTTTAATTTTC ATGTTGCGGAGCCCCTACTACAAGTATGAAGAGAAAAGAAAAAAAAAATGA |
Restriction Sites | NotI-NotI |
ACCN | NM_014573 |
Insert Size | 2500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequnced and found to be a perfect match to NM_014573.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014573.2, NP_055388.2 |
RefSeq Size | 2585 bp |
RefSeq ORF | 531 bp |
Locus ID | 27346 |
UniProt ID | Q5BJF2 |
Protein Families | Transmembrane |
Gene Summary | TMEM97 is a conserved integral membrane protein that plays a role in controlling cellular cholesterol levels (Bartz et al., 2009 [PubMed 19583955]).[supplied by OMIM, Aug 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216927 | TMEM97 (Myc-DDK-tagged)-Human transmembrane protein 97 (TMEM97) |
CNY 2,400.00 |
|
RC216927L1 | Lenti ORF clone of Human transmembrane protein 97 (TMEM97), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216927L2 | Lenti ORF clone of Human transmembrane protein 97 (TMEM97), mGFP tagged |
CNY 5,890.00 |
|
RC216927L3 | Lenti ORF clone of Human transmembrane protein 97 (TMEM97), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216927L4 | Lenti ORF clone of Human transmembrane protein 97 (TMEM97), mGFP tagged |
CNY 4,800.00 |
|
RG216927 | TMEM97 (tGFP-tagged) - Human transmembrane protein 97 (TMEM97) |
CNY 4,000.00 |
|
SC107367 | TMEM97 (untagged)-Human transmembrane protein 97 (TMEM97) |
CNY 1,200.00 |