TMEM188 (CNEP1R1) (NM_153261) Human Untagged Clone
CAT＃: SC317242
CNEP1R1 (untagged)-Human transmembrane protein 188 (TMEM188)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C16orf69; NEP1-R1; NEP1R1; TMEM188; TMP125 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317242 representing NM_153261.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACTCGCTGGAGCAGGCGGAAGCCCCGCGAGTTGTATCCCTGATTCCTGCGGTGGTTTCCGGTAAC TGCCAAGATCTCAAGGCTTTTGAGAGGAGACTTACTGAATATATTCATTGTTTGCAACCTGCTACTGGA CGCTGGAGAATGCTTCTTATAGTGGTATCTGTCTGTACAGCTACTGGTGCCTGGAACTGGTTAATAGAC CCTGAGACACAAAAGGTGTCCTTCTTCACATCATTATGGAATCACCCATTTTTCACCATTAGCTGTATC ACTCTAATAGGCTTGTTCTTTGCTGGAATACACAAGAGAGTAGTTGCACCATCAATTATAGCTGCTCGA TGTCGAACGGTATTAGCAGAATACAATATGTCTTGTGATGATACAGGAAAACTAATTTTGAAACCTAGG CCTCATGTTCAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_153261 |
| Insert Size | 429 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_153261.5 |
| RefSeq Size | 2201 bp |
| RefSeq ORF | 429 bp |
| Locus ID | 255919 |
| UniProt ID | Q8N9A8 |
| MW | 16 kDa |
| Gene Summary | This gene encodes a transmembrane protein that belongs to the Tmemb_18A family. A similar protein in yeast is a component of an endoplasmic reticulum-associated protein phosphatase complex and is thought to play a role in the synthesis of triacylglycerol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC207243 | CNEP1R1 (Myc-DDK-tagged)-Human transmembrane protein 188 (TMEM188) |
CNY 1200.00 |
|
| RC207243L3 | Lenti ORF clone of Human transmembrane protein 188 (TMEM188), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC207243L4 | Lenti ORF clone of Human transmembrane protein 188 (TMEM188), mGFP tagged |
CNY 5890.00 |
|
| RG207243 | CNEP1R1 (tGFP-tagged) - Human transmembrane protein 188 (TMEM188) |
CNY 2800.00 |
|
| SC100975 | CNEP1R1 (untagged)-Human transmembrane protein 188 (TMEM188) |
CNY 1200.00 |
其它TMEM188产品
