BOLA3 (NM_212552) Human Untagged Clone
CAT#: SC317227
BOLA3 (untagged)-Human bolA homolog 3 (E. coli) (BOLA3), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MMDS2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_212552, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCATGGAGCCCGGCCGCGGCAGCGCCTCTCCTCCGCGGGATCCGCGGGCTTCCA CTTCACCATCGGATGTTTGCCACTCAGACTGAGGGGGAGCTCAGAGTGACCCAAATTCTC AAAGAAAAGTTTCCACGAGCTACAGCTATAAAAGTCACTGACATTTCAGGAGGTTGTGGG GCGATGTATGAAATTAAAATTGAATCAGAAGAATTTAAGGAGAAGAGAACTGTCCAGCAG CACCAGATGGTTAATCAGGCACTAAAAGAAGAAATCAAAGAGATGCATGGATTGCGGATA TTTACCTCTGTCCCCAAACGC |
Restriction Sites | Please inquire |
ACCN | NM_212552 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_212552.2, NP_997717.2 |
RefSeq Size | 554 bp |
RefSeq ORF | 324 bp |
Locus ID | 388962 |
UniProt ID | Q53S33 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a protein that plays an essential role in the production of iron-sulfur (Fe-S) clusters for the normal maturation of lipoate-containing 2-oxoacid dehydrogenases, and for the assembly of the mitochondrial respiratory chain complexes. Mutation in this gene has been associated with multiple mitochondrial dysfunctions syndrome-2. Two alternatively spliced transcript variants encoding different isoforms with distinct subcellular localization have been reported for this gene (PMID:21944046). [provided by RefSeq, Dec 2011] Transcript Variant: This variant (1) encodes the longer isoform (1), which is localized to the mitochondria (PMID:21944046). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223665 | BOLA3 (Myc-DDK-tagged)-Human bolA homolog 3 (E. coli) (BOLA3), transcript variant 1 |
CNY 3990.00 |
|
RC223665L3 | Lenti-ORF clone of BOLA3 (Myc-DDK-tagged)-Human bolA homolog 3 (E. coli) (BOLA3), transcript variant 1 |
CNY 5890.00 |
|
RC223665L4 | Lenti-ORF clone of BOLA3 (mGFP-tagged)-Human bolA homolog 3 (E. coli) (BOLA3), transcript variant 1 |
CNY 5890.00 |
|
RG223665 | BOLA3 (tGFP-tagged) - Human bolA homolog 3 (E. coli) (BOLA3), transcript variant 1 |
CNY 2920.00 |
|
SC126104 | BOLA3 (untagged)-Human bolA homolog 3 (E. coli) (BOLA3), transcript variant 1 |
CNY 1200.00 |