NRXN3 (NM_001105250) Human Untagged Clone

CAT#: SC317095

NRXN3 (untagged)-Human neurexin 3 (NRXN3), transcript variant 3



  "NM_001105250" in other vectors (6)

CNY 7320.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NRXN3 Antibody - C-terminal region
    • 50 ug

CNY 4628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C14orf60
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317095 representing NM_001105250.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACCTGAGAATCCACGCGAGACGGAGCCCTCCTCGCCGGCCGGCCTGGACGCTTGGGATCTGGTTC
CTGTTCTGGGGATGTATCGTCAGCTCTGTATGGAGTTCTTCTAATGTAGCTTCCTCCTCCTCCACCTCT
TCCTCGCCGGGGTCTCACTCTCAGCACGAGCACCATTTCCATGGCAGCAAGCATCACTCAGTGCCTATT
TCTATCTATCGTTCCCCTGTTTCCCTTCGAGGAGGACACGCTGGCGCTACGTACATCTTTGGGAAAAGT
GGTGGGCTTATCCTCTACACCTGGCCAGCCAATGACAGGCCCAGCACGCGGTCTGACCGCCTTGCCGTG
GGCTTCAGCACCACTGTGAAGGATGGCATCTTGGTCCGCATCGACAGTGCTCCAGGACTTGGTGACTTC
CTCCAGCTTCACATAGAACAGGGGAAAATTGGAGTTGTCTTCAACATTGGCACAGTTGACATCTCCATC
AAAGAGGAGAGAACCCCTGTAAATGACGGCAAATACCATGTGGTACGCTTCACCAGGAACGGCGGCAAC
GCCACCCTGCAGGTGGACAACTGGCCAGTGAATGAACATTATCCTACAGGCAACACTGATAATGAACGC
TTCCAAATGGTAAAACAGAAAATCCCCTTCAAATATAATCGGCCTGTAGAGGAGTGGCTGCAGGAAAAA
GGCCGGCAGTTAACCATCTTCAACACTCAGGCGCAAATAGCCATTGGTGGAAAGGACAAAGGACGCCTC
TTCCAAGGCCAACTCTCTGGGCTCTATTATGATGGTTTGAAAGTACTGAACATGGCGGCTGAGAACAAC
CCCAATATTAAAATCAATGGAAGTGTTCGGCTGGTTGGAGAAGTCCCATCAATTTTGGGAACAACACAG
ACGACCTCCATGCCACCAGAAATGTCTACTACTGTCATGGAAACCACTACTACAATGGCGACTACCACA
ACCCGTAAGAATCGCTCTACAGCCAGCATTCAGCCAACATCAGATGATCTTGTTTCATCTGCTGAATGT
TCAAGTGATGATGAAGACTTTGTTGAATGTGAGCCGAGTACAGCAAACCCCACGGAGCCGGGAATCAGA
CGGGTTCCGGGGGCCTCAGAGGTGATCCGGGAGTCGAGCAGCACAACAGGGATGGTCGTCGGCATTGTG
GCTGCTGCCGCCCTCTGCATCTTGATCCTCCTGTACGCCATGTACAAGTACAGGAACAGGGACGAGGGG
TCCTATCAAGTGGACGAGACGCGGAACTACATCAGCAACTCCGCCCAGAGCAACGGCACGCTCATGAAG
GAGAAGCAGCAGAGCTCGAAGAGCGGCCACAAGAAACAGAAAAACAAGGACAGGGAGTATTACGTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001105250
Insert Size 1380 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001105250.2
RefSeq Size 8659 bp
RefSeq ORF 1380 bp
Locus ID 9369
UniProt ID Q9HDB5
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 50.7 kDa
Gene Summary This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants and protein isoforms for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. Genetic variation at this locus has been associated with a range of behavioral phenotypes, including alcohol dependence and autism spectrum disorder. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (3) differs in the 5' UTR and contains multiple differences in the coding region, including the lack of multiple 5' exons, compared to variant 1. It initiates translation at an alternate start codon. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1. This variant encodes a beta isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...