TBX22 (NM_001109879) Human Untagged Clone
CAT#: SC317084
TBX22 (untagged)-Human T-box 22 (TBX22), transcript variant 3
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ABERS; CLPA; CPX; dJ795G23.1; TBXX |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001109879, the custom clone sequence may differ by one or more nucleotides
ATGTTCCCCTCTGTTCGGGTCAAGGTGAAAGGGTTGGATCCAGGGAAGCAGTACCATGTG GCCATCGATGTGGTGCCGGTGGATTCCAAACGCTATAGGTACGTCTATCACAGCTCACAG TGGATGGTAGCTGGGAATACAGACCATTTGTGCATCATTCCTAGATTCTATGTTCACCCG GACTCACCCTGCTCGGGAGAGACCTGGATGCGGCAGATCATCAGCTTTGATCGCATGAAA CTCACCAACAATGAGATGGATGACAAAGGCCACATCATTCTGCAATCCATGCATAAGTAC AAACCCCGAGTGCACGTGATAGAGCAAGGCAGCAGTGTTGACCTGTCCCAGATTCAGTCC TTGCCCACTGAAGGTGTTAAAACATTCTCCTTTAAAGAAACTGAGTTCACCACAGTAACG GCTTACCAAAACCAACAGATTACGAAACTAAAAATAGAAAGAAATCCTTTTGCTAAAGGA TTTAGAGATACTGGAAGAAACAGGGGTGTATTGGATGGGCTTTTAGAGACCTACCCATGG AGGCCTTCTTTCACTCTCGATTTTAAAACCTTTGGCGCAGACACACAAAGTGGAAGCAGT GGCTCATCTCCAGTGACCTCTAGTGGAGGGGCCCCCTCTCCTTTGAACTCCTTACTTTCT CCACTTTGCTTTTCACCTATGTTTCATTTACCTACAAGCTCCCTTGGAATGCCCTGTCCA GAGGCATACCTGCCCAATGTCAACCTGCCTCTATGCTACAAGATTTGTCCAACTAATTTT TGGCAACAGCAACCTCTTGTTTTACCGGCTCCTGAAAGACTAGCAAGCAGCAACAGTTCT CAGTCTTTAGCCCCACTCATGATGGAAGTGCCTATGTTATCTTCCCTGGGGGTCACCAAT TCAAAAAGCGGTTCATCTGAAGACTCCAGTGATCAGTATCTACAAGCACCTAATTCTACC AATCAAATGTTATATGGATTACAGTCACCTGGAAATATTTTTCTGCCAAACTCCATCACC CCAGAAGCACTTAGTTGCTCCTTTCATCCTTCCTATGACTTTTATAGATACAATTTCTCT ATGCCATCTAGACTGATAAGTGGTTCCAACCATCTTAAAGTGAATGACGACAGTCAAGTT TCTTTTGGAGAAGGCAAATGTAATCATGTTCATTGGTATCCAGCAATTAACCATTACCTT |
Restriction Sites | Please inquire |
ACCN | NM_001109879 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001109879.1, NP_001103349.1 |
RefSeq Size | 2351 bp |
RefSeq ORF | 1203 bp |
Locus ID | 50945 |
UniProt ID | Q9Y458 |
Protein Families | Transcription Factors |
Gene Summary | This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Mutations in this gene have been associated with the inherited X-linked disorder, Cleft palate with ankyloglossia, and it is believed to play a major role in human palatogenesis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alternate splice donor site, and it thus differs in its 5' UTR and initiates translation from an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Both variants 3 and 4 encode isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225624 | TBX22 (Myc-DDK-tagged)-Human T-box 22 (TBX22), transcript variant 3 |
CNY 5230.00 |
|
RC225624L3 | Lenti-ORF clone of TBX22 (Myc-DDK-tagged)-Human T-box 22 (TBX22), transcript variant 3 |
CNY 7130.00 |
|
RC225624L4 | Lenti-ORF clone of TBX22 (mGFP-tagged)-Human T-box 22 (TBX22), transcript variant 3 |
CNY 7130.00 |
|
RG225624 | TBX22 (tGFP-tagged) - Human T-box 22 (TBX22), transcript variant 3 |
CNY 5700.00 |