KRTAP9-9 (NM_030975) Human Untagged Clone

CAT#: SC317035

KRTAP9 (untagged)-Human keratin associated protein 9-9 (KRTAP9-9)



  "NM_030975" in other vectors (2)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KAP9.5; KAP9.9; KRTAP9-5; KRTAP9.9
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_030975, the custom clone sequence may differ by one or more nucleotides
ATGACCCACTGTTGCTCCCCTTGCTGTCAGCCTACCTGCTGCAGGACCACCTGCTGCAGG
ACCACCTGCTGGAAGCCCACCACTGTGACCACCTGCAGCAGCACACCCTGCTGCCAGCCC
TCCTGCTGTGTGTCTAGCTGCTGCCAGCCTTGCTGCCGCCCAGCTTGCTGTCAAAACACC
TGCTGCAGGACCACCTGCTGCCAGCCCACCTGTCTGTCCAGCTGCTGTGGCCAAACCAGC
TGTGGGTCCAGCTGTGGCCAGAGCAGCTCCTGTGCACCTGTGTACTGCAGAAGAACCTGC
TACTACCCGACGACTGTCTGCCTGCCTGGTTGCCTCAACCAGAGCTGTGGATCCAGCTGC
TGCCAGCCCTGCTGCCGCCCCGCCTGCTGTGAGACCACCTGCTGCAGGACCACTTGCTTC
CAGCCCACCTGTGTGTCCAGCTGCTGCCAGCCTTCTTGCTGC
Restriction Sites Please inquire     
ACCN NM_030975
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_030975.1, NP_112237.1
RefSeq Size 953 bp
RefSeq ORF 465 bp
Locus ID 81870
UniProt ID Q9BYP9
Gene Summary This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. Alternative haplotypes of this gene are represented in the GRCh38 reference genome assembly. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (KRTAP9.5) lacks an in-frame segment of the 5' coding region and includes a base change in the 3' UTR, compared to variant KRTAP9.9. The encoded isoform (KRTAP9.5) is 5 aa shorter than isoform KRTAP9.9. This variant is produced from the primary chromosome 17 assembly unit of the GRCh38 reference genome assembly. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. COMPLETENESS: complete on the 3' end.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...