RRAS2 (NM_001102669) Human Untagged Clone

CAT#: SC316896

RRAS2 (untagged)-Human related RAS viral (r-ras) oncogene homolog 2 (RRAS2), transcript variant 2



  "NM_001102669" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to TC21 (related RAS viral (r-ras) oncogene homolog 2)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NS12; TC21
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001102669, the custom clone sequence may differ by one or more nucleotides
ATGAGAGAACAGTATATGAGGACTGGCGAAGGCTTCCTGTTGGTCTTTTCAGTCACAGAT
AGAGGCAGTTTTGAAGAAATCTATAAGTTTCAAAGACAGATTCTCAGAGTAAAGGATCGT
GATGAGTTCCCAATGATTTTAATTGGTAATAAAGCAGATCTGGATCATCAAAGACAGGTA
ACACAGGAAGAAGGACAACAGTTAGCACGGCAGCTTAAGGTAACATACATGGAGGCATCA
GCAAAGATTAGGATGAATGTAGATCAAGCTTTCCATGAACTTGTCCGGGTTATCAGGAAA
TTTCAAGAGCAGGAATGTCCTCCTTCACCAGAACCAACACGGAAAGAAAAAGACAAGAAA
GGCTGCCATTGTGTCATTTTC
Restriction Sites Please inquire     
ACCN NM_001102669
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001102669.1, NP_001096139.1
RefSeq Size 2153 bp
RefSeq ORF 384 bp
Locus ID 22800
UniProt ID P62070
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction
Gene Summary This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Both variants 2 and 4 encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...