CNPY1 (NM_001103176) Human Untagged Clone
CAT#: SC316889
CNPY1 (untagged)-Human canopy 1 homolog (zebrafish) (CNPY1)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316889 representing NM_001103176.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACGACTACAAGCTTGAGGAAGACCCTGTGACGAAGGAGAGAACTTTCAAGAGATTCGCTCCTAGG AAAGGAGACAAAATATACCAAGAATTTAAAAAATTGTATTTTTATTCTGATGCTTACAGACCTTTGAAA TTTGCGTGTGAAACTATAATAGAAGAGTATGAAGATGAAATATCCTCACTTATCGCCCAGGAGACACAC TATCTAGCTGACAAGCTGTGCAGTGAAAAATCAGATCTGTGTGAAACTTCTGCTAATCATACTGAGCTC TAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001103176 |
Insert Size | 279 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001103176.1 |
RefSeq Size | 2234 bp |
RefSeq ORF | 279 bp |
Locus ID | 285888 |
UniProt ID | Q3B7I2 |
MW | 11 kDa |
Gene Summary | Cnpy1 is expressed in the midbrain-hindbrain (MHB) boundary in zebrafish, binds FGFR1 (MIM 136350), and plays a role in FGF signaling (Hirate and Okamoto, 2006 [PubMed 16488878]).[supplied by OMIM, Dec 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215924 | CNPY1 (Myc-DDK-tagged)-Human canopy 1 homolog (zebrafish) (CNPY1) |
CNY 1200.00 |
|
RC215924L3 | Lenti ORF clone of Human canopy 1 homolog (zebrafish) (CNPY1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC215924L4 | Lenti ORF clone of Human canopy 1 homolog (zebrafish) (CNPY1), mGFP tagged |
CNY 5890.00 |
|
RG215924 | CNPY1 (tGFP-tagged) - Human canopy 1 homolog (zebrafish) (CNPY1) |
CNY 4370.00 |