NPW (NM_001099456) Human Untagged Clone
CAT#: SC316664
NPW (untagged)-Human neuropeptide W (NPW)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | L8; L8C; PPL8; PPNPW |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001099456, the custom clone sequence may differ by one or more nucleotides
CTGGCGTGGCGCCCAGGGGAGCGGGGGGCTCCCGCGAGCCGGCCGCGGCTGGCACTGCTGCTGCTTCTGC TCCTGCTGCCGCTGCCCTCCGGCGCGTGGTACAAGCACGTGGCGAGTCCCCGCTACCACACGGTGGGCCG CGCCGCTGGCCTGCTCATGGGGCTGCGTCGCTCACCCTATCTGTGGCGCCGCGCGCTGCGCGCGGCCGCC GGGCCCCTGGCCAGGGACACCCTCTCCCCCGAACCCGCAGCCCGCGAGGCTCCTCTCCTGCTGCCCTCGT GGGTTCAGGAGCTGTGGGAGACGCGACGCAGGAGCTCCCAGGCAGGGATCCCCGTCCGTGCGCCCCGGAG CCCGCGCGCCCCAGAGCCTGCGCTGGAACCGGAGTCCCTGGACTTCAGCGGAGCTGGCCAGAGACTTCGG AGAGACGTCTCCCGCCCAGCGGTGGACCCCGCAGCAAACCGCCTTGGCCTGCCCTGCCTGGCCCCCGGAC CGTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001099456 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001099456.2, NP_001092926.2 |
RefSeq Size | 1033 bp |
RefSeq ORF | 498 bp |
Locus ID | 283869 |
UniProt ID | Q8N729 |
Gene Summary | The product of this gene is processed into 23- and 30-amino acid neuropeptides that bind and activate two G-protein coupled receptors in the central nervous system. The neuropeptides have been shown to enhance cortisol secretion from adrenal cells through the adenylate cyclase/protein kinase A signaling cascade. The preproprotein is translated using a non-AUG initiation codon that is inferred from analyses of the mouse ortholog. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223697 | NPW (Myc-DDK-tagged)-Human neuropeptide W (NPW) |
CNY 2400.00 |
|
RC223697L3 | Lenti ORF clone of Human neuropeptide W (NPW), Myc-DDK-tagged |
CNY 5890.00 |
|
RC223697L4 | Lenti ORF clone of Human neuropeptide W (NPW), mGFP tagged |
CNY 5890.00 |
|
RG223697 | NPW (tGFP-tagged) - Human neuropeptide W (NPW) |
CNY 4370.00 |