Cytochrome b5 (CYB5A) (NM_001914) Human Untagged Clone
CAT#: SC316637
CYB5A (untagged)-Human cytochrome b5 type A (microsomal) (CYB5A), transcript variant 2
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CYB5; MCB5; METAG |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001914 edited
GGGGAATGTCCCGGGTGGAGCTGGCTGAGTCGCGCGCTCTGCTCCACCCGACGGGGCTGT GTGTGCTGGGCCTGGCTCGCGGCGAACCGAGATGGCAGAGCAGTCGGACGAGGCCGTGAA GTACTACACCCTAGAGGAGATTCAGAAGCACAACCACAGCAAGAGCACCTGGCTGATCCT GCACCACAAGGTGTACGATTTGACCAAATTTCTGGAAGAGCATCCTGGTGGGGAAGAAGT TTTAAGGGAACAAGCTGGAGGTGACGCTACTGAGAACTTTGAGGATGTCGGGCACTCTAC AGATGCCAGGGAAATGTCCAAAACATTCATCATTGGGGAGCTCCATCCAGATGACAGACC AAAGTTAAACAAGCCTCCGGAACCTTAAAGGCGGTGTTTCAAGGAAACTCTTATCACTAC TATTGATTCTAGTTCCAGTTGGTGGACCAACTGGGTGATCCCTGCCATCTCTGCAGTGGC CGTCGCCTTGATGTATCGCCTATACATGGCAGAGGACTGAACACCTCCTCAGAAGTCAGC GCAGGAAGAGCCTGCTTTGGACACGGGAGAAAAGAAGCCATTGCTAACTACTTCAACTGA CAGAAACCTTCACTTGAAAACAATGATTTTAATATATCTCTTTCTTTTTCTTCCGACATT AGAAACAAAACAAAAAGAACTGTCCTTTCTGCGCTCAAATTTTTCGAGTGTGCCTTTTTA TTCATCTACTTTATTTTGATGTTTCCTTAATGTGTAATTTACTTATTATAAGCATGATCT TTTAAAAATATATTTGGCTTTTAAAGTAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001914 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001914.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001914.2, NP_001905.1 |
RefSeq Size | 844 bp |
RefSeq ORF | 297 bp |
Locus ID | 1528 |
UniProt ID | P00167 |
Domains | heme_1 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a membrane-bound cytochrome that reduces ferric hemoglobin (methemoglobin) to ferrous hemoglobin, which is required for stearyl-CoA-desaturase activity. Defects in this gene are a cause of type IV hereditary methemoglobinemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (2) has an additional exon in the 3' coding region, which introduces a stop codon, as compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221889 | CYB5A (Myc-DDK-tagged)-Human cytochrome b5 type A (microsomal) (CYB5A), transcript variant 2 |
CNY 3990.00 |
|
RC221889L3 | Lenti-ORF clone of CYB5A (Myc-DDK-tagged)-Human cytochrome b5 type A (microsomal) (CYB5A), transcript variant 2 |
CNY 5890.00 |
|
RC221889L4 | Lenti-ORF clone of CYB5A (mGFP-tagged)-Human cytochrome b5 type A (microsomal) (CYB5A), transcript variant 2 |
CNY 5890.00 |
|
RG221889 | CYB5A (tGFP-tagged) - Human cytochrome b5 type A (microsomal) (CYB5A), transcript variant 2 |
CNY 4370.00 |
其它Cytochrome b5产品