Cytochrome b5 (CYB5A) (NM_001914) Human Untagged Clone

CAT#: SC316637

CYB5A (untagged)-Human cytochrome b5 type A (microsomal) (CYB5A), transcript variant 2



  "NM_001914" in other vectors (4)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-CYB5A Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CYB5; MCB5; METAG
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001914 edited
GGGGAATGTCCCGGGTGGAGCTGGCTGAGTCGCGCGCTCTGCTCCACCCGACGGGGCTGT
GTGTGCTGGGCCTGGCTCGCGGCGAACCGAGATGGCAGAGCAGTCGGACGAGGCCGTGAA
GTACTACACCCTAGAGGAGATTCAGAAGCACAACCACAGCAAGAGCACCTGGCTGATCCT
GCACCACAAGGTGTACGATTTGACCAAATTTCTGGAAGAGCATCCTGGTGGGGAAGAAGT
TTTAAGGGAACAAGCTGGAGGTGACGCTACTGAGAACTTTGAGGATGTCGGGCACTCTAC
AGATGCCAGGGAAATGTCCAAAACATTCATCATTGGGGAGCTCCATCCAGATGACAGACC
AAAGTTAAACAAGCCTCCGGAACCTTAAAGGCGGTGTTTCAAGGAAACTCTTATCACTAC
TATTGATTCTAGTTCCAGTTGGTGGACCAACTGGGTGATCCCTGCCATCTCTGCAGTGGC
CGTCGCCTTGATGTATCGCCTATACATGGCAGAGGACTGAACACCTCCTCAGAAGTCAGC
GCAGGAAGAGCCTGCTTTGGACACGGGAGAAAAGAAGCCATTGCTAACTACTTCAACTGA
CAGAAACCTTCACTTGAAAACAATGATTTTAATATATCTCTTTCTTTTTCTTCCGACATT
AGAAACAAAACAAAAAGAACTGTCCTTTCTGCGCTCAAATTTTTCGAGTGTGCCTTTTTA
TTCATCTACTTTATTTTGATGTTTCCTTAATGTGTAATTTACTTATTATAAGCATGATCT
TTTAAAAATATATTTGGCTTTTAAAGTAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001914
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001914.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001914.2, NP_001905.1
RefSeq Size 844 bp
RefSeq ORF 297 bp
Locus ID 1528
UniProt ID P00167
Domains heme_1
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a membrane-bound cytochrome that reduces ferric hemoglobin (methemoglobin) to ferrous hemoglobin, which is required for stearyl-CoA-desaturase activity. Defects in this gene are a cause of type IV hereditary methemoglobinemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (2) has an additional exon in the 3' coding region, which introduces a stop codon, as compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...