MSL1 (NM_001012241) Human Untagged Clone

CAT#: SC316507

MSL1 (untagged)-Human male-specific lethal 1 homolog (Drosophila) (MSL1)



  "NM_001012241" in other vectors (6)

CNY 7220.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MSL1 Antibody - middle region
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MSL-1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001012241, the custom clone sequence may differ by one or more nucleotides


ATGGAAAGGCGGATGCAGCTGGTAAAGAAGGATAACGAGAAAGAAAGGCACAAGCTGTTTCAGGGCTATG
AAACTGAAGAGAGAGAGGAAACAGAGCTATCTGAGAAAATTAAACTGGAGTGCCAGCCGGAGCTTTCCGA
GACATCCCAGACTCTGCCTCCCAAGCCCTTCTCATGTGGGCGGAGTGGAAAGGGACATAAAAGGAAATCC
CCATTTGGAAGTACAGAAAGAAAGACTCCTGTTAAAAAGCTGGCTCCTGAATTTTCAAAAGTCAAAACAA
AAACTCCTAAGCACTCTCCTATTAAAGAGGAACCCTGTGGTTCCTTATCTGAAACTGTTTGTAAACGTGA
ATTGAGGAGCCAAGAAACCCCAGAAAAGCCCCGGTCTTCAGTGGACACCCCACCAAGACTCTCCACTCCC
CAAAAGGGACCCAGCACCCATCCCAAGGAGAAAGCCTTCTCAAGTGAGATAGAAGATTTGCCGTACCTTT
CCACCACAGAAATGTATTTGTGTCGTTGGCACCAGCCTCCCCCATCACCGTTACCATTACGGGAATCCTC
TCCAAAGAAGGAGGAGACTGTAGCAAGGTGTCTGATGCCATCAAGTGTTGCAGGAGAAACTTCAGTCTTG
GCTGTTCCTTCTTGGAGGGACCACTCAGTAGAGCCTCTAAGGGACCCAAATCCTTCAGACCTTTTGGAGA
ACCTGGATGACAGTGTGTTTTCGAAGCGGCATGCAAAACTGGAGCTGGATGAGAAGAGAAGGAAAAGATG
GGATATTCAGAGGATCAGGGAACAAAGAATTTTACAGCGACTGCAGCTCAGAATGTATAAAAAGAAAGGA
ATTCAGGAATCTGAGCCTGAGGTTACCTCATTTTTCCCTGAGCCAGATGATGTTGAAAGTTTGATGATTA
CCCCCTTCTTGCCTGTTGTAGCATTTGGACGACCATTACCAAAATTAACTCCACAGAATTTTGAGCTACC
CTGGTTGGATGAGCGTAGCCGATGCAGATTGGAGATCCAGAAGAAGCAAACACCTCACCGGACGTGTAGG
AAATAG


Restriction Sites NotI-NotI     
ACCN NM_001012241
Insert Size 4300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001012241.1, but the ORF of this cDNA clone is 789bp longer than the reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001012241.1, NP_001012241.1
RefSeq Size 3834 bp
RefSeq ORF 1056 bp
Locus ID 339287
UniProt ID Q68DK7
Gene Summary Component of histone acetyltransferase complex responsible for the majority of histone H4 acetylation at 'Lys-16' (H4K16ac) which is implicated in the formation of higher-order chromatin structure (PubMed:16227571). Greatly enhances MSL2 E3 ubiquitin ligase activity, promoting monoubiquitination of histone H2B at 'Lys-34' (H2BK34Ub) (PubMed:21726816). This modification in turn stimulates histone H3 methylation at 'Lys-4' (H3K4me) and 'Lys-79' (H3K79me) and leads to gene activation, including that of HOXA9 and MEIS1 (PubMed:21726816). In the MSL complex, acts as a scaffold to tether MSL3 and KAT8 together for enzymatic activity regulation (PubMed:22547026).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...