ATXN7L3 (NM_001098833) Human Untagged Clone

CAT#: SC316504

ATXN7L3 (untagged)-Human ataxin 7-like 3 (ATXN7L3), transcript variant 2



  "NM_001098833" in other vectors (4)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ATXN7L3 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DKFZp761G2113
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316504 representing NM_001098833.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAAATGGAGGAAATGTCTTTGTCTGGCCTGGATAACAGCAAACTAGAGGCCATCGCTCAGGAGATA
TACGCGGACCTGGTCGAGGATTCTTGTTTGGGATTCTGCTTTGAGGTACACCGGGCTGTCAAGTGTGGC
TACTTCTTCTTGGACGACACGGACCCTGATAGCATGAAGGATTTTGAGATCGTGGACCAGCCGGGCTTG
GACATCTTTGGACAGGTTTTCAACCAGTGGAAGAGCAAGGAGTGTGTTTGCCCCAATTGCAGTCGCAGC
ATTGCCGCCTCCCGCTTTGCTCCCCATCTGGAGAAGTGCCTGGGAATGGGTCGGAACAGCAGCCGAATC
GCCAACCGCCGGATTGCCAATAGCAACAATATGAATAAGTCTGAGAGTGACCAAGAAGATAATGATGAC
ATCAATGACAACGACTGGTCCTATGGCTCGGAGAAGAAAGCCAAGAAGAGAAAGTCAGACAAGAACCCC
AATTCCCCTCGAAGATCCAAGTCATTAAAACACAAAAATGGGGAACTTAGCAATTCGGATCCTTTTAAG
TATAACAATTCAACTGGGATCAGCTATGAGACCCTGGGGCCGGAGGAGCTTCGCAGCCTGCTAACCACG
CAATGTGGGGTGATTTCTGAACACACCAAGAAGATGTGCACAAGGTCCCTGCGCTGCCCACAGCACACA
GATGAGCAGAGGCGAACCGTACGGATTTATTTTCTCGGGCCCTCGGCTGTCCTTCCAGAGGTCGAGAGC
TCCCTGGATAATGACAGCTTTGACATGACTGACAGCCAGGCCCTGATCAGCCGGCTTCAGTGGGACGGC
TCCTCTGACCTCTCACCCTCTGATTCAGGCTCCTCCAAGACGAGTGAAAATCAGGGATGGGGTCTAGGT
ACCAACAGCTCTGAGTCACGGAAAACCAAGAAAAAGAAATCCCATCTGAGCCTGGTAGGGACTGCCTCC
GGCCTAGGTTCCAACAAGAAGAAGAAGCCAAAGCCACCGGCACCCCCGACGCCCAGCATCTATGATGAC
ATCAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001098833
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001098833.1
RefSeq Size 3635 bp
RefSeq ORF 1044 bp
Locus ID 56970
UniProt ID Q14CW9
MW 38.7 kDa
Gene Summary Component of the transcription regulatory histone acetylation (HAT) complex SAGA, a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates in a subcomplex that specifically deubiquitinates both histones H2A and H2B (PubMed:18206972, PubMed:21746879). The SAGA complex is recruited to specific gene promoters by activators such as MYC, where it is required for transcription. Required for nuclear receptor-mediated transactivation. Within the complex, it is required to recruit USP22 and ENY2 into the SAGA complex (PubMed:18206972). Regulates H2B monoubiquitination (H2Bub1) levels. Affects subcellular distribution of ENY2, USP22 and ATXN7L3B (PubMed:27601583).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...