COQ10A (NM_001099337) Human Untagged Clone
CAT＃: SC316485
COQ10A (untagged)-Human coenzyme Q10 homolog A (S. cerevisiae) (COQ10A), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316485 representing NM_001099337.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTTTTGCAAGTTGTACGAGAAGGGAAGTTCTCGGGGTTTCTGACCTCCTGCAGCCTCCTCTTGCCT CGGGCTGCCCAGATCTTGGCGGCTGAGGCTGGCTTACCTTCGAGCCGTTCCTTCATGGGATTTGCTGCT CCCTTCACCAACAAGCGAAAGGCTTACTCGGAGCGTAGAATCATGGGGTACTCAATGCAGGAGATGTAT GAGGTGGTGTCCAACGTCCAGGAGTATCGTGAGTTTGTGCCCTGGTGTAAGAAGTCTCTGGTGGTATCC AGCCGTAAGGGTCATTTGAAAGCCCAGCTGGAGGTTGGCTTTCCACCTGTCATGGAACGTTACACCTCT GCAGTTTCCATGGTCAAACCTCACATGGTCAAGGCTGTTTGTACTGATGGCAAGCTCTTCAACCACTTA GAGACTATTTGGCGATTCAGCCCTGGTATTCCTGCCTATCCTCGAACCTGCACTGTGGACTTTTCGATT TCCTTTGAATTTCGTTCTCTGCTGCACTCCCAGCTGGCCACCATGTTTTTTGATGAGGTTGTCAAACAG AATGTTGCTGCCTTTGAGCGTCGGGCAGCCACCAAGTTTGGTCCAGAAACAGCCATCCCCCGTGAACTG ATGTTCCATGAGGTGCACCAGACTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001099337 |
| Insert Size | 648 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001099337.1 |
| RefSeq Size | 1430 bp |
| RefSeq ORF | 648 bp |
| Locus ID | 93058 |
| UniProt ID | Q96MF6 |
| MW | 24.5 kDa |
| Gene Summary | Required for the function of coenzyme Q in the respiratory chain. May serve as a chaperone or may be involved in the transport of Q6 from its site of synthesis to the catalytic sites of the respiratory complexes (Probable).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate 5' exon, which produces a unique 5' UTR and causes translation initiation at a unique start codon, compared to variant 1. The encoded protein (isoform b) is shorter and has a distinct N-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212115 | COQ10A (Myc-DDK-tagged)-Human coenzyme Q10 homolog A (S. cerevisiae) (COQ10A), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2400.00 |
|
| RC212115L3 | Lenti-ORF clone of COQ10A (Myc-DDK-tagged)-Human coenzyme Q10 homolog A (S. cerevisiae) (COQ10A), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5890.00 |
|
| RC212115L4 | Lenti-ORF clone of COQ10A (mGFP-tagged)-Human coenzyme Q10 homolog A (S. cerevisiae) (COQ10A), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5890.00 |
|
| RG212115 | COQ10A (tGFP-tagged) - Human coenzyme Q10 homolog A (S. cerevisiae) (COQ10A), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4370.00 |
