Mammaglobin A (SCGB2A2) (NM_002411) Human Untagged Clone
CAT#: SC316462
SCGB2A2 (untagged)-Human secretoglobin, family 2A, member 2 (SCGB2A2)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MGB1; PSBP1; UGB2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_002411 edited
ATGAAGTTGCTGATGGTCCTCATGCTGGCGGCCCTCTCCCAGCACTGCTACGCAGGCTCT GGCTGCCCCTTATTGGAGAATGTGATTTCCAAGACAATCAATCCACAAGTGTCTAAGACT GAATACAAAGAACTTCTTCAAGAGTTCATAGACGACAATGCCACTACAAATGCCATAGAT GAATTGAAGGAATGTTTTCTTAACCAAACGGATGAAACTCTGAGCAATGTTGAGGTGTTT ATGCAATTAATATATGACAGCAGTCTTTGTGATTTATTTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002411 |
| Insert Size | 1300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | no |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002411.2, NP_002402.1 |
| RefSeq Size | 502 bp |
| RefSeq ORF | 282 bp |
| Locus ID | 4250 |
| UniProt ID | Q13296 |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224550 | SCGB2A2 (Myc-DDK-tagged)-Human secretoglobin, family 2A, member 2 (SCGB2A2) |
CNY 1200.00 |
|
| RC224550L3 | Lenti ORF clone of Human secretoglobin, family 2A, member 2 (SCGB2A2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC224550L4 | Lenti ORF clone of Human secretoglobin, family 2A, member 2 (SCGB2A2), mGFP tagged |
CNY 5890.00 |
|
| RG224550 | SCGB2A2 (tGFP-tagged) - Human secretoglobin, family 2A, member 2 (SCGB2A2) |
CNY 2800.00 |
其它Mammaglobin A产品
