SCXA (SCX) (NM_001080514) Human Untagged Clone
CAT#: SC316344
SCXB (untagged)-Human scleraxis homolog B (mouse) (SCXB)
CNY 2400.00
CNY 3990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bHLHa48; SCXA; SCXB |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001080514 edited
AGATCTGGTACCGATATCAAGCTTGCGGCCGCAGGAGGCGGCATGAGCAGCGCGCGACAG AGCTGACGCCGCGCCCCCGCCGGCCCCATGTCCTTCGCCACGCTGCGCCCGGCGCCGCCG GGCCGCTACCTGTACCCCGAGGTGAGCCCGCTGTCGGAGGACGAGGACCGCGGCAGCGAC AGCTCGGGCTCCGACGAGAAACCCTGTCGCGTGCACGCGGCGCGCTGCGGCCTCCAGGGC GCCCGGCGGAGGGCGGGGGGCCGGCGGGCCGGGGGCGGGGGGCCAGGGGGCCGGCCAGGC CGTGAGCCCCGGCAGCGGCACACGGCGAACGCGCGCGAGCGAGACCGCACCAACAGCGTG AACACGGCCTTCACGGCGCTGCGCACGCTGATCCCCACCGAGCCCGCCGACCGCAAGCTC TCCAAGATTGAGACGCTGCGCCTGGCCTCCAGCTACATCTCGCACCTGGGCAACGTGCTG CTGGCGGGCGAGGCCTGCGGCGACGGACAGCCCTGCCACTCCGGGCCCGCCTTCTTCCAC GCGGCGCGCGCCGGCAGCCCCCCGCCGCCGCCCCCGCCGCCTCCCGCCCGCGACGGCGAG AACACCCAGCCCAAACAGATCTGCACCTTCTGCCTCAGCAACCAGAGAAAGTTGAGCAAG GACCGCGACAGAAAGACAGCGATTCGCAGTTAGGAGGTGGCCGGCAGCAGCCAGGAGGCA GACGCTGCTGGGGGAGGTGGACGCCCGGGGTGACTGCAGACAGCCCCCACCTTGGACCTG AGCTGGGCAAGGCCCACCGCAAGCATGCCCCCAGGCCAGCCCTGGCTGCGAGCGGGGCCG AGGGACAGACGGACGTACAGACAGGCGCCGGCAGCGGGACTCTGCGCTGGCCCCAGCACC TGCCCGGGCCCACTGGAACTTTCTGCGCTGGCTTTTCTTCCGGCCACTGTGTGATGGCAT ACTTGTGTTTTTGATATGATAATATAAAGTC |
| Restriction Sites | Please inquire |
| ACCN | NM_001080514 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | ORF matches with that of NM_001080514.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001080514.1, NP_001073983.1 |
| RefSeq Size | 606 bp |
| RefSeq ORF | 606 bp |
| Locus ID | 642658 |
| UniProt ID | Q7RTU7 |
| Gene Summary | Plays an early essential role in mesoderm formation, as well as a later role in formation of somite-derived chondrogenic lineages.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
The Transcription Factor SCX is a Potential Serum Biomarker of Fibrotic Diseases
,null,
International Journal of Molecular Sciences
,PubMed ID 32708589
[SCXA]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224305 | SCXB (Myc-DDK-tagged)-Human scleraxis homolog B (mouse) (SCXB) |
CNY 2400.00 |
|
| RC224305L1 | Lenti-ORF clone of SCXB (Myc-DDK-tagged)-Human scleraxis homolog B (mouse) (SCXB) |
CNY 5890.00 |
|
| RC224305L2 | Lenti-ORF clone of SCXB (mGFP-tagged)-Human scleraxis homolog B (mouse) (SCXB) |
CNY 4800.00 |
|
| RC224305L3 | Lenti-ORF clone of SCXB (Myc-DDK-tagged)-Human scleraxis homolog B (mouse) (SCXB) |
CNY 5890.00 |
|
| RC224305L4 | Lenti-ORF clone of SCXB (mGFP-tagged)-Human scleraxis homolog B (mouse) (SCXB) |
CNY 5890.00 |
|
| RG224305 | SCXB (tGFP-tagged) - Human scleraxis homolog B (mouse) (SCXB) |
CNY 4000.00 |
