Tcl1 (TCL1A) (NM_001098725) Human Untagged Clone
CAT＃: SC316327
TCL1A (untagged)-Human T-cell leukemia/lymphoma 1A (TCL1A), transcript variant 2
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TCL1 |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001098725 edited
ATGGCCGAGTGCCCGACACTCGGGGAGGCAGTCACCGACCACCCGGACCGCCTGTGGGCC TGGGAGAAGTTCGTGTATTTGGACGAGAAGCAGCACGCCTGGCTGCCCTTAACCATCGAG ATAAAGGATAGGTTACAGTTACGGGTGCTCTTGCGTCGGGAAGACGTCGTCCTGGGGAGG CCTATGACCCCCACCCAGATAGGCCCAAGCCTGCTGCCTATCATGTGGCAGCTCTACCCT GATGGACGATACCGATCCTCAGACTCCAGTTTCTGGCGCTTAGTGTACCACATCAAGATT GACGGCGTGGAGGACATGCTTCTCGAGCTGCTGCCAGATGACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001098725 |
| Insert Size | 350 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001098725.1, NP_001092195.1 |
| RefSeq Size | 1405 bp |
| RefSeq ORF | 345 bp |
| Locus ID | 8115 |
| UniProt ID | P56279 |
| Protein Families | Druggable Genome |
| Gene Summary | Overexpression of the TCL1 gene in humans has been implicated in the development of mature T cell leukemia, in which chromosomal rearrangements bring the TCL1 gene in close proximity to the T-cell antigen receptor (TCR)-alpha (MIM 186880) or TCR-beta (MIM 186930) regulatory elements (summarized by Virgilio et al., 1998 [PubMed 9520462]). In normal T cells TCL1 is expressed in CD4-/CD8- cells, but not in cells at later stages of differentiation. TCL1 functions as a coactivator of the cell survival kinase AKT (MIM 164730) (Laine et al., 2000 [PubMed 10983986]).[supplied by OMIM, Jul 2010] Transcript Variant: This variant (2) uses an alternate splice site in the 3' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213051 | TCL1A (Myc-DDK-tagged)-Human T-cell leukemia/lymphoma 1A (TCL1A), transcript variant 2 |
CNY 1200.00 |
|
| RC213051L3 | Lenti ORF clone of Human T-cell leukemia/lymphoma 1A (TCL1A), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC213051L4 | Lenti ORF clone of Human T-cell leukemia/lymphoma 1A (TCL1A), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG213051 | TCL1A (tGFP-tagged) - Human T-cell leukemia/lymphoma 1A (TCL1A), transcript variant 2 |
CNY 4370.00 |
