GPR18 (NM_001098200) Human Untagged Clone
CAT＃: SC316183
GPR18 (untagged)-Human G protein-coupled receptor 18 (GPR18), transcript variant 2
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001098200, the custom clone sequence may differ by one or more nucleotides
ATGATCACCCTGAACAATCAAGATCAACCTGTCCCTTTTAACAGCTCACATCCAGATGAATACAAAATTG CAGCCCTTGTCTTCTATAGCTGTATCTTCATAATTGGATTATTTGTTAACATCACTGCATTATGGGTTTT CAGTTGTACCACCAAGAAGAGAACCACGGTAACCATCTATATGATGAATGTGGCATTAGTGGACTTGATA TTTATAATGACTTTACCCTTTCGAATGTTTTATTATGCAAAAGATGAATGGCCATTTGGAGAGTACTTCT GCCAGATTCTTGGAGCTCTCACAGTGTTTTACCCAAGCATTGCTTTATGGCTTCTTGCCTTTATTAGTGC TGACAGATACATGGCCATTGTACAGCCGAAGTACGCCAAAGAACTTAAAAACACGTGCAAAGCCGTGCTG GCGTGTGTGGGAGTCTGGATAATGACCCTGACCACGACCACCCCTCTGCTACTGCTCTATAAAGACCCAG ATAAAGACTCCACTCCCGCCACCTGCCTCAAGATTTCTGACATCATCTATCTAAAAGCTGTGAACGTGCT GAACCTCACTCGACTGACATTTTTTTTCTTGATTCCTTTGTTCATCATGATTGGGTGCTACTTGGTCATT ATTCATAATCTCCTTCACGGCAGGACGTCTAAGCTGAAACCCAAAGTCAAGGAGAAGTCCATAAGGATCA TCATCACGCTGCTGGTGCAGGTGCTCGTCTGCTTTATGCCCTTCCACATCTGTTTCGCTTTCCTGATGCT GGGAACGGGGGAGAACAGTTACAATCCCTGGGGAGCCTTTACCACCTTCCTCATGAACCTCAGCACGTGT CTGGATGTGATTCTCTACTACATCGTTTCAAAACAATTTCAGGCTCGAGTCATTAGTGTCATGCTATACC GTAATTACCTTCGAAGCATGCGCAGAAAAAGTTTCCGATCTGGTAGTCTACGGTCACTAAGCAATATAAA CAGTGAAATGTTATGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001098200 |
| Insert Size | 1400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001098200.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001098200.1, NP_001091670.1 |
| RefSeq Size | 1484 bp |
| RefSeq ORF | 996 bp |
| Locus ID | 2841 |
| UniProt ID | Q14330 |
| Protein Families | Druggable Genome, GPCR, Transmembrane |
| Gene Summary | Receptor for endocannabinoid N-arachidonyl glycine (NAGly) (PubMed:16844083, PubMed:24762058, PubMed:27572937). However, conflicting results about the role of NAGly as an agonist are reported (PubMed:27018161). Can also be activated by plant-derived and synthetic cannabinoid agonists (PubMed:24762058). The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase (PubMed:16844083). May contribute to regulation of the immune system. Is required for normal homeostasis of CD8+ subsets of intraepithelial lymphocytes (IELs) (CD8alphaalpha and CD8alphabeta IELs)in small intstine by supporting preferential migration of CD8alphaalpha T-cells to intraepithelial compartment over lamina propria compartment, and by mediating their reconstitution into small intestine after bone marrow transplant (By similarity). Plays a role in hypotensive responses, mediating reduction in intraocular and blood pressure (By similarity). Mediates NAGly-induced process of reorganization of actin filaments and induction of acrosomal exocytosis (PubMed:27572937).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217482 | GPR18 (Myc-DDK-tagged)-Human G protein-coupled receptor 18 (GPR18), transcript variant 2 |
CNY 2400.00 |
|
| RC217482L3 | Lenti ORF clone of Human G protein-coupled receptor 18 (GPR18), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC217482L4 | Lenti ORF clone of Human G protein-coupled receptor 18 (GPR18), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG217482 | GPR18 (tGFP-tagged) - Human G protein-coupled receptor 18 (GPR18), transcript variant 2 |
CNY 4000.00 |
