GPR18 (NM_001098200) Human Untagged Clone

CAT#: SC316183

GPR18 (untagged)-Human G protein-coupled receptor 18 (GPR18), transcript variant 2



  "NM_001098200" in other vectors (4)

CNY 6270.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-GPR18 antibody
    • 100 ul

CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001098200, the custom clone sequence may differ by one or more nucleotides


ATGATCACCCTGAACAATCAAGATCAACCTGTCCCTTTTAACAGCTCACATCCAGATGAATACAAAATTG
CAGCCCTTGTCTTCTATAGCTGTATCTTCATAATTGGATTATTTGTTAACATCACTGCATTATGGGTTTT
CAGTTGTACCACCAAGAAGAGAACCACGGTAACCATCTATATGATGAATGTGGCATTAGTGGACTTGATA
TTTATAATGACTTTACCCTTTCGAATGTTTTATTATGCAAAAGATGAATGGCCATTTGGAGAGTACTTCT
GCCAGATTCTTGGAGCTCTCACAGTGTTTTACCCAAGCATTGCTTTATGGCTTCTTGCCTTTATTAGTGC
TGACAGATACATGGCCATTGTACAGCCGAAGTACGCCAAAGAACTTAAAAACACGTGCAAAGCCGTGCTG
GCGTGTGTGGGAGTCTGGATAATGACCCTGACCACGACCACCCCTCTGCTACTGCTCTATAAAGACCCAG
ATAAAGACTCCACTCCCGCCACCTGCCTCAAGATTTCTGACATCATCTATCTAAAAGCTGTGAACGTGCT
GAACCTCACTCGACTGACATTTTTTTTCTTGATTCCTTTGTTCATCATGATTGGGTGCTACTTGGTCATT
ATTCATAATCTCCTTCACGGCAGGACGTCTAAGCTGAAACCCAAAGTCAAGGAGAAGTCCATAAGGATCA
TCATCACGCTGCTGGTGCAGGTGCTCGTCTGCTTTATGCCCTTCCACATCTGTTTCGCTTTCCTGATGCT
GGGAACGGGGGAGAACAGTTACAATCCCTGGGGAGCCTTTACCACCTTCCTCATGAACCTCAGCACGTGT
CTGGATGTGATTCTCTACTACATCGTTTCAAAACAATTTCAGGCTCGAGTCATTAGTGTCATGCTATACC
GTAATTACCTTCGAAGCATGCGCAGAAAAAGTTTCCGATCTGGTAGTCTACGGTCACTAAGCAATATAAA
CAGTGAAATGTTATGA


Restriction Sites NotI-NotI     
ACCN NM_001098200
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001098200.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001098200.1, NP_001091670.1
RefSeq Size 1484 bp
RefSeq ORF 996 bp
Locus ID 2841
UniProt ID Q14330
Protein Families Druggable Genome, GPCR, Transmembrane
Gene Summary Receptor for endocannabinoid N-arachidonyl glycine (NAGly) (PubMed:16844083, PubMed:24762058, PubMed:27572937). However, conflicting results about the role of NAGly as an agonist are reported (PubMed:27018161). Can also be activated by plant-derived and synthetic cannabinoid agonists (PubMed:24762058). The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase (PubMed:16844083). May contribute to regulation of the immune system. Is required for normal homeostasis of CD8+ subsets of intraepithelial lymphocytes (IELs) (CD8alphaalpha and CD8alphabeta IELs)in small intstine by supporting preferential migration of CD8alphaalpha T-cells to intraepithelial compartment over lamina propria compartment, and by mediating their reconstitution into small intestine after bone marrow transplant (By similarity). Plays a role in hypotensive responses, mediating reduction in intraocular and blood pressure (By similarity). Mediates NAGly-induced process of reorganization of actin filaments and induction of acrosomal exocytosis (PubMed:27572937).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...