CD272 (BTLA) (NM_001085357) Human Untagged Clone
CAT#: SC316167
BTLA (untagged)-Human B and T lymphocyte associated (BTLA), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BTLA1; CD272 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316167 representing NM_001085357.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGACATTGCCTGCCATGCTTGGAACTGGGAAATTATTTTGGGTCTTCTTCTTAATCCCATATCTG GACATCTGGAACATCCATGGGAAAGAATCATGTGATGTACAGCTTTATATAAAGAGACAATCTGAACAC TCCATCTTAGCAGGAGATCCCTTTGAACTAGAATGCCCTGTGAAATACTGTGCTAACAGGCCTCATGTG ACTTGGTGCAAGCTCAATGGAACAACATGTGTAAAACTTGAAGATAGACAAACAAGTTGGAAGGAAGAG AAGAACATTTCATTTTTCATTCTACATTTTGAACCAGTGCTTCCTAATGACAATGGGTCATACCGCTGT TCTGCAAATTTTCAGTCTAATCTCATTGAAAGCCACTCAACAACTCTTTATGTGACAGGAAAGCAAAAT GAACTCTCTGACACAGCAGGAAGGGAAATTAACCTGGTTGATGCTCACCTTAAGAGTGAGCAAACAGAA GCAAGCACCAGGCAAAATTCCCAAGTACTGCTATCAGAAACTGGAATTTATGATAATGACCCTGACCTT TGTTTCAGGATGCAGGAAGGGTCTGAAGTTTATTCTAATCCATGCCTGGAAGAAAACAAACCAGGCATT GTTTATGCTTCCCTGAACCATTCTGTCATTGGACCGAACTCAAGACTGGCAAGAAATGTAAAAGAAGCA CCAACAGAATATGCATCCATATGTGTGAGGAGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001085357 |
Insert Size | 726 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001085357.1 |
RefSeq Size | 3072 bp |
RefSeq ORF | 726 bp |
Locus ID | 151888 |
UniProt ID | Q7Z6A9 |
Protein Families | Transmembrane |
MW | 27.3 kDa |
Gene Summary | This gene encodes a member of the immunoglobulin superfamily. The encoded protein contains a single immunoglobulin (Ig) domain and is a receptor that relays inhibitory signals to suppress the immune response. Alternative splicing results in multiple transcript variants. Polymorphisms in this gene have been associated with an increased risk of rheumatoid arthritis. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220628 | BTLA (Myc-DDK-tagged)-Human B and T lymphocyte associated (BTLA), transcript variant 2 |
CNY 2400.00 |
|
RC220628L1 | Lenti ORF clone of Human B and T lymphocyte associated (BTLA), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC220628L2 | Lenti ORF clone of Human B and T lymphocyte associated (BTLA), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC220628L3 | Lenti ORF clone of Human B and T lymphocyte associated (BTLA), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC220628L4 | Lenti ORF clone of Human B and T lymphocyte associated (BTLA), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG220628 | BTLA (tGFP-tagged) - Human B and T lymphocyte associated (BTLA), transcript variant 2 |
CNY 4370.00 |