MRAS (NM_001085049) Human Untagged Clone
CAT#: SC316159
MRAS (untagged)-Human muscle RAS oncogene homolog (MRAS), transcript variant 2
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | M-RAs; NS11; R-RAS3; RRAS3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001085049, the custom clone sequence may differ by one or more nucleotides
ATGGCAACCAGCGCCGTCCCCAGTGACAACCTCCCCACATACAAGCTGGTGGTGGTGGGG GATGGGGGTGTGGGCAAAAGTGCCCTCACCATCCAGTTTTTCCAGAAGATCTTTGTGCCT GACTATGACCCCACCATTGAAGACTCCTACCTGAAACATACGGAGATTGACAATCAATGG GCCATCTTGGACGTTCTGGACACAGCTGGGCAGGAGGAATTCAGCGCCATGCGGGAGCAA TACATGCGCACGGGGGATGGCTTCCTCATCGTCTACTCCGTCACTGACAAGGCCAGCTTT GAGCACGTGGACCGCTTCCACCAGCTTATCCTGCGCGTCAAAGACAGGGAGTCATTCCCG ATGATCCTCGTGGCCAACAAGGTCGATTTGATGCACTTGAGGAAGATCACCAGGGAGCAA GGAAAAGAAATGGCGACCAAACACAATATTCCGTACATAGAAACCAGTGCCAAGGACCCA CCTCTCAATGTCGACAAAGCCTTCCATGACCTCGTTAGAGTAATTAGGCAACAGATTCCG GAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAATGGCGGGGAGACCGGGCCACAGGCACC CACAAACTGCAATGTGTGATCTTG |
Restriction Sites | Please inquire |
ACCN | NM_001085049 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001085049.1, NP_001078518.1 |
RefSeq Size | 4013 bp |
RefSeq ORF | 627 bp |
Locus ID | 22808 |
UniProt ID | O14807 |
Protein Families | Druggable Genome |
Protein Pathways | MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction |
Gene Summary | This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218272 | MRAS (Myc-DDK-tagged)-Human muscle RAS oncogene homolog (MRAS), transcript variant 2 |
CNY 3600.00 |
|
RC218272L3 | Lenti-ORF clone of MRAS (Myc-DDK-tagged)-Human muscle RAS oncogene homolog (MRAS), transcript variant 2 |
CNY 6000.00 |
|
RC218272L4 | Lenti-ORF clone of MRAS (mGFP-tagged)-Human muscle RAS oncogene homolog (MRAS), transcript variant 2 |
CNY 5890.00 |
|
RG218272 | MRAS (tGFP-tagged) - Human muscle RAS oncogene homolog (MRAS), transcript variant 2 |
CNY 4370.00 |