XAGE1C (NM_001097597) Human Untagged Clone

CAT#: SC316131

XAGE1C (untagged)-Human X antigen family, member 1C (XAGE1C), transcript variant a



  "NM_001097597" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT12.1; CT12.1C; CTP9; GAGED2; XAGE-1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001097597, the custom clone sequence may differ by one or more nucleotides
ATGCTCCTTTGGTGCCCACCTCAGTGCGCATGTTCACTGGGCGTCTTCCCATCGGCCCCT
TCGCCAGTGTGGGGAACGCGGCGGAGCTGTGAGCCGGCGACTCGGGTCCCTGAGGTCTGG
ATTCTTTCTCCGCTACTGAGACACGGCGGACACACACAAACACAGAACCACACAGCCAGT
CCCAGGAGCCCAGTAATGGAGAGCCCCAAAAAGAAGAACCAGCAGCTGAAAGTCGGGATC
CTACACCTGGGCAGCAGACAGAAGAAGATCAGGATACAGCTGAGATCCCAGTGCGCGACA
TGGAAGGTGATCTGCAAGAGCTGCATCAGTCAAACACCGGGGATAAATCTGGATTTGGGT
TCCGGCGTCAAGGTGAAGATAATACCTAAAGAGGAACACTGTAAAATGCCAGAAGCAGGT
GAAGAGCAACCACAAGTT
Restriction Sites Please inquire     
ACCN NM_001097597
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001097597.1, NP_001091066.1
RefSeq Size 614 bp
RefSeq ORF 441 bp
Locus ID 653048
Gene Summary This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (a, also known as XAGE-1a) encodes the longer isoform (a, also known as isoform XAGE-1b). This variant also includes a major downstream transcription start site, which results in the variant referred to as XAGE-1b in the literature. Both XAGE-1a and XAGE-1b encode the same isoform. This RefSeq contains an in-frame start site 65 codons upstream from the currently annotated site but is not being annotated as a start site since it is in a weak Kozak sequence context and experimental evidence indicates that the downstream AUG is used. (PMID: 12479262 and PMID: 17335148).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...