POLR2J2 (POLR2J3) (NM_001097615) Human Untagged Clone

CAT#: SC316107

POLR2J3 (untagged)-Human polymerase (RNA) II (DNA directed) polypeptide J3 (POLR2J3)



  "NM_001097615" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-POLR2J3 antibody (N-term)
    • 400 ul

CNY 6314.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms POLR2J2; RPB11b1; RPB11b2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316107 representing NM_001097615.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACGCCCCTCCAGCCTTCGAGTCGTTCTTGCTCTTCGAGGGCGAGAAGATCACCATTAACAAGGAC
ACCAAGGTACCCAATGCCTGTTTATTCACCATCAACAAAGAAGACCACACACTGGGAAACATCATTAAA
TCACAACTCCTAAAAGACCCGCAAGTGCTATTTGCTGGCTACAAAGTCCCCCACCCCTTGGAGCACAAG
ATCATCATCCGAGTGCAGACCACGCCGGACTACAGCCCCCAGGAAGCCTTTACCAACGCCATCACCGAC
CTCATCAGTGAGCTGTCCCTGCTGGAGGAGCGCTTCCGGACGTGCCTGCTTCCCCTTCGCCTTCTGCCG
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001097615
Insert Size 348 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001097615.2
RefSeq Size 1680 bp
RefSeq ORF 348 bp
Locus ID 548644
UniProt ID Q9GZM3
Protein Pathways Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
MW 13.1 kDa
Gene Summary This gene is a member of the RNA polymerase II subunit 11 gene family, which includes three genes in a cluster on chromosome 7q22.1 and a pseudogene on chromosome 7p13. The founding member of this family, DNA directed RNA polymerase II polypeptide J, has been shown to encode a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This locus produces multiple, alternatively spliced transcripts that potentially express isoforms with distinct C-termini compared to DNA directed RNA polymerase II polypeptide J. Most or all variants are spliced to include additional non-coding exons at the 3' end which makes them candidates for nonsense-mediated decay (NMD). Consequently, it is not known if this locus expresses a protein or proteins in vivo. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...