CHMP1A (NM_001083314) Human Untagged Clone
CAT#: SC315983
CHMP1A (untagged)-Human chromatin modifying protein 1A (CHMP1A), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CHMP1; PCH8; PCOLN3; PRSM1; VPS46-1; VPS46A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315983 representing NM_001083314.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACGTTCACGGCGAAGCAGCTGGAGAAGCTGGCCAAGAAGGCGGAGAAGGACTCCAAGGCGGAGCA GGCCAAAGTGAAGAAGGCCCTTCTGCAGAAAAATGTAGAGTGTGCCCGTGTGTATGCCGAGAACGCCAT CCGCAAGAAGAACGAAGGTGTGAACTGGCTTCGGATGGCGTCCCGCGTAGACGCAGTGGCCTCCAAGGT GCAGACAGCTGTGACTATGAAGGGGGTGACCAAGAATATGGCCCAGGTGACCAAAGCCCTGGACAAGGC CCTGAGCACCATGGACCTGCAGAAGGTCTCCTCAGTGATGGACAGGTTCGAGCAGCAGGTGCAGAACCT GGACGTCCATACATCGGTGATGGAGGACTCCATGAGCTCGGCCACCACCCTGACCACGCCGCAGGAGCA GGTGGACAGCCTCATCATGCAGATCGCCGAGGAGAATGGCCTGGAGGTGCTGGACCAGCTCAGCCAGCT GCCCGAGGGCGCCTCTGCCGTGGGCGAGAGCTCTGTGCGCAGCCAGGAGGACCAGCTGTCACGGAGGTT GGCCGCCTTGAGGAACTAGCCGTGCCCCGCCGGTGTGCACCGCCTCTGCCCCGTGATGTGCTGGAAGGC TCCTGTCCTCTCCCCACCGCGTCTTGCCTTTGTGCTGACCCCGCGGGGCTGCGGCCGGCAGCCACTCTG CGTCTCTCACCTGCCAGGCCTGCGTGGCCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001083314 |
Insert Size | 723 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001083314.3 |
RefSeq Size | 2408 bp |
RefSeq ORF | 723 bp |
Locus ID | 5119 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 24.7 kDa |
Gene Summary | This gene encodes a member of the CHMP/Chmp family of proteins which are involved in multivesicular body sorting of proteins to the interiors of lysosomes. The initial prediction of the protein sequence encoded by this gene suggested that the encoded protein was a metallopeptidase. The nomenclature has been updated recently to reflect the correct biological function of this encoded protein. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (1) lacks an alternate exon in the 5' coding region that results in a frameshift in subsequent regions of the CDS, compared to variant 2. The encoded isoform (1) shares the first two residues but is otherwise distinct and longer than isoform 2. Translation of this isoform is assumed due to use of the expected start codon, which has a strong Kozak signal. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216566 | CHMP1A (Myc-DDK-tagged)-Human chromatin modifying protein 1A (CHMP1A), transcript variant 1 |
CNY 2400.00 |
|
RC216566L3 | Lenti ORF clone of Human chromatin modifying protein 1A (CHMP1A), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC216566L4 | Lenti ORF clone of Human chromatin modifying protein 1A (CHMP1A), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG216566 | CHMP1A (tGFP-tagged) - Human chromatin modifying protein 1A (CHMP1A), transcript variant 1 |
CNY 4370.00 |