LILRB4 (NM_001081438) Human Untagged Clone

CAT#: SC315950

LILRB4 (untagged)-Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 (LILRB4), transcript variant 2



  "NM_001081438" in other vectors (3)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
LILRB4 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD85K; HM18; ILT3; LILRB5; LIR-5; LIR5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315950 representing NM_001081438.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCCCCACCTTCACGGCTCTGCTCTGCCTCGGGCTGAGTCTGGGCCCCAGGACCCACATGCAGGCA
GGGCCCCTCCCCAAACCCACCCTCTGGGCTGAGCCAGGCTCTGTGATCAGCTGGGGGAACTCTGTGACC
ATCTGGTGTCAGGGGACCCTGGAGGCTCGGGAGTACCGTCTGGATAAAGAGGAAAGCCCAGCACCCTGG
GACAGACAGAACCCACTGGAGCCCAAGAACAAGGCCAGATTCTCCATCCCATCCATGACAGAGGACTAT
GCAGGGAGATACCGCTGTTACTATCGCAGCCCTGTAGGCTGGTCACAGCCCAGTGACCCCCTGGAGCTG
GTGATGACAGGAGCCTACAGTAAACCCACCCTTTCAGCCCTGCCGAGTCCTCTTGTGACCTCAGGAAAG
AGCGTGACCCTGCTGTGTCAGTCACGGAGCCCAATGGACACTTTCCTTCTGATCAAGGAGCGGGCAGCC
CATCCCCTACTGCATCTGAGATCAGAGCACGGAGCTCAGCAGCACCAGGCTGAATTCCCCATGAGTCCT
GTGACCTCAGTGCACGGGGGGACCTACAGGTGCTTCAGCTCACACGGCTTCTCCCACTACCTGCTGTCA
CACCCCAGTGACCCCCTGGAGCTCATAGTCTCAGGATCCTTGGAGGATCCCAGGCCCTCACCCACAAGG
TCCGTCTCAACAGCTGCAGGCCCTGAGGACCAGCCCCTCATGCCTACAGGGTCAGTCCCCCACAGTGGT
CTGAGAAGGCACTGGGAGGTACTGATCGGGGTCTTGGTGGTCTCCATCCTGCTTCTCTCCCTCCTCCTC
TTCCTCCTCCTCCAACACTGGCGTCAGGGAAAACACAGGACATTGGCCCAGAGACAGGCTGATTTCCAA
CGTCCTCCAGGGGCTGCCGAGCCAGAGCCCAAGGACGGGGGCCTACAGAGGAGGTCCAGCCCAGCTGCT
GACGTCCAGGGAGAAAACTTCTGTGCTGCCGTGAAGAACACACAGCCTGAGGACGGGGTGGAAATGGAC
ACTCGGAGCCCACACGATGAAGACCCCCAGGCAGTGACGTATGCCAAGGTGAAACACTCCAGACCTAGG
AGAGAAATGGCCTCTCCTCCCTCCCCACTGTCTGGGGAATTCCTGGACACAAAGGACAGACAGGCAGAA
GAGGACAGACAGATGGACACTGAGGCTGCTGCATCTGAAGCCCCCCAGGATGTGACCTACGCCCAGCTG
CACAGCTTTACCCTCAGACAGAAGGCAACTGAGCCTCCTCCATCCCAGGAAGGGGCCTCTCCAGCTGAG
CCCAGTGTCTATGCCACTCTGGCCATCCACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001081438
Insert Size 1344 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001081438.1
RefSeq Size 2094 bp
RefSeq ORF 1344 bp
Locus ID 11006
Protein Families Transmembrane
MW 49.2 kDa
Gene Summary This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a protein (isoform 2) that is 1 aa shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...