beta Defensin 3 (DEFB103A) (NM_001081551) Human Untagged Clone
CAT＃: SC315911
DEFB103A (untagged)-Human defensin, beta 103A (DEFB103A)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BD-3; DEFB-3; DEFB3; DEFB103; HBD3; HBP-3; HBP3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001081551, the custom clone sequence may differ by one or more nucleotides
ATGAGGATCCATTATCTTCTGTTTGCTTTGCTCTTCCTGTTTTTGGTGCCTGTTCCAGGT CATGGAGGAATCATAAACACATTACAGAAATATTATTGCAGAGTCAGAGGCGGCCGGTGT GCTGTGCTCAGCTGCCTTCCAAAGGAGGAACAGATCGGCAAGTGCTCGACGCGTGGCCGA AAATGCTGCCGAAGAAAGAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001081551 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001081551.2, NP_001075020.1 |
| RefSeq Size | 437 bp |
| RefSeq ORF | 204 bp |
| Locus ID | 414325 |
| UniProt ID | P81534 |
| Protein Families | Transmembrane |
| Gene Summary | Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 103, an antibiotic peptide which is induced by bacteria and interferon gamma, and which displays antimicrobial activity against S. aureus, S. pyogenes, P. aeruginosa, E. coli, and C. albicans. [provided by RefSeq, Oct 2014] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216712 | DEFB103A (Myc-DDK-tagged)-Human defensin, beta 103A (DEFB103A) |
CNY 1200.00 |
|
| RC216712L3 | Lenti-ORF clone of DEFB103A (Myc-DDK-tagged)-Human defensin, beta 103A (DEFB103A) |
CNY 5890.00 |
|
| RC216712L4 | Lenti-ORF clone of DEFB103A (mGFP-tagged)-Human defensin, beta 103A (DEFB103A) |
CNY 5890.00 |
|
| RG216712 | DEFB103A (tGFP-tagged) - Human defensin, beta 103A (DEFB103A) |
CNY 2800.00 |
其它beta Defensin 3产品
