GJC1 (NM_001080383) Human Untagged Clone
CAT＃: SC315749
GJC1 (untagged)-Human gap junction protein, gamma 1, 45kDa (GJC1), transcript variant 2
CNY 3656.00
CNY 6460.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CX45; GJA7 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001080383, the custom clone sequence may differ by one or more nucleotides
ATGAGTTGGAGCTTCCTGACTCGCCTGCTAGAGGAGATTCACAACCATTCCACATTTGTG GGGAAGATCTGGCTCACTGTTCTGATTGTCTTCCGGATCGTCCTTACAGCTGTAGGAGGA GAATCCATCTATTACGATGAGCAAAGCAAATTTGTGTGCAACACAGAACAGCCGGGCTGT GAGAATGTCTGTTATGATGCGTTTGCACCTCTCTCCCATGTACGCTTCTGGGTGTTCCAG ATCATCCTGGTGGCAACTCCCTCTGTGATGTACCTGGGCTATGCTATCCACAAGATTGCC AAAATGGAGCACGGTGAAGCAGACAAGAAGGCAGCTCGGAGCAAGCCCTATGCAATGCGC TGGAAACAACACCGGGCTCTGGAAGAAACGGAGGAGGACAACGAAGAGGATCCTATGATG TATCCAGAGATGGAGTTAGAAAGTGATAAGGAAAATAAAGAGCAGAGCCAACCCAAACCT AAGCATGATGGCCGACGACGGATTCGGGAAGATGGGCTCATGAAAATCTATGTGCTGCAG TTGCTGGCAAGGACCGTGTTTGAGGTGGGTTTTCTGATAGGGCAGTATTTTCTGTATGGC TTCCAAGTCCACCCGTTTTATGTGTGCAGCAGACTTCCTTGTCCTCATAAGATAGACTGC TTTATTTCTAGACCCACTGAAAAGACCATCTTCCTTCTGATAATGTATGGTGTTACAGGC CTTTGCCTCTTGCTTAACATTTGGGAGATGCTTCATTTAGGGTTTGGGACCATTCGAGAC TCACTAAACAGTAAAAGGAGGGAACTTGAGGATCCGGGTGCTTATAATTATCCTTTCACT TGGAATACACCATCTGCTCCCCCTGGCTATAACATTGCTGTCAAACCAGATCAAATCCAG TACACCGAACTGTCCAATGCTAAGATCGCCTACAAGCAAAACAAGGCCAACACAGCCCAG GAACAGCAGTATGGCAGCCATGAGGAGAACCTCCCAGCTGACCTGGAGGCTCTGCAGCGG GAGATCAGGATGGCTCAGGAACGCTTGGATCTGGCAGTTCAGGCCTACAGTCACCAAAAC AACCCTCATGGTCCCCGGGAGAAGAAGGCCAAAGTGGGGTCCAAAGCTGGGTCCAACAAA AGCACTGCCAGTAGCAAATCAGGGGATGGGAAGACCTCCGTCTGGATT |
| Restriction Sites | Please inquire |
| ACCN | NM_001080383 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001080383.1, NP_001073852.1 |
| RefSeq Size | 7640 bp |
| RefSeq ORF | 1191 bp |
| Locus ID | 10052 |
| UniProt ID | P36383 |
| Protein Families | Ion Channels: Other, Transmembrane |
| Gene Summary | This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218725 | GJC1 (Myc-DDK-tagged)-Human gap junction protein, gamma 1, 45kDa (GJC1), transcript variant 2 |
CNY 4024.00 |
|
| RC218725L3 | Lenti-ORF clone of GJC1 (Myc-DDK-tagged)-Human gap junction protein, gamma 1, 45kDa (GJC1), transcript variant 2 |
CNY 5890.00 |
|
| RC218725L4 | Lenti-ORF clone of GJC1 (mGFP-tagged)-Human gap junction protein, gamma 1, 45kDa (GJC1), transcript variant 2 |
CNY 5890.00 |
|
| RG218725 | GJC1 (tGFP-tagged) - Human gap junction protein, gamma 1, 45kDa (GJC1), transcript variant 2 |
CNY 4370.00 |
