ACVRL1 (NM_001077401) Human Untagged Clone

CAT#: SC315576

ACVRL1 (untagged)-Human activin A receptor type II-like 1 (ACVRL1), transcript variant 2



  "NM_001077401" in other vectors (6)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ACVRL1 mouse monoclonal antibody,clone OTI5C2
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACVRLK1; ALK-1; ALK1; HHT; HHT2; ORW2; SKR3; TSR-I
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315576 representing NM_001077401.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCTTGGGCTCCCCCAGGAAAGGCCTTCTGATGCTGCTGATGGCCTTGGTGACCCAGGGAGACCCT
GTGAAGCCGTCTCGGGGCCCGCTGGTGACCTGCACGTGTGAGAGCCCACATTGCAAGGGGCCTACCTGC
CGGGGGGCCTGGTGCACAGTAGTGCTGGTGCGGGAGGAGGGGAGGCACCCCCAGGAACATCGGGGCTGC
GGGAACTTGCACAGGGAGCTCTGCAGGGGGCGCCCCACCGAGTTCGTCAACCACTACTGCTGCGACAGC
CACCTCTGCAACCACAACGTGTCCCTGGTGCTGGAGGCCACCCAACCTCCTTCGGAGCAGCCGGGAACA
GATGGCCAGCTGGCCCTGATCCTGGGCCCCGTGCTGGCCTTGCTGGCCCTGGTGGCCCTGGGTGTCCTG
GGCCTGTGGCATGTCCGACGGAGGCAGGAGAAGCAGCGTGGCCTGCACAGCGAGCTGGGAGAGTCCAGT
CTCATCCTGAAAGCATCTGAGCAGGGCGACAGCATGTTGGGGGACCTCCTGGACAGTGACTGCACCACA
GGGAGTGGCTCAGGGCTCCCCTTCCTGGTGCAGAGGACAGTGGCACGGCAGGTTGCCTTGGTGGAGTGT
GTGGGAAAAGGCCGCTATGGCGAAGTGTGGCGGGGCTTGTGGCACGGTGAGAGTGTGGCCGTCAAGATC
TTCTCCTCGAGGGATGAACAGTCCTGGTTCCGGGAGACTGAGATCTATAACACAGTGTTGCTCAGACAC
GACAACATCCTAGGCTTCATCGCCTCAGACATGACCTCCCGCAACTCGAGCACGCAGCTGTGGCTCATC
ACGCACTACCACGAGCACGGCTCCCTCTACGACTTTCTGCAGAGACAGACGCTGGAGCCCCATCTGGCT
CTGAGGCTAGCTGTGTCCGCGGCATGCGGCCTGGCGCACCTGCACGTGGAGATCTTCGGTACACAGGGC
AAACCAGCCATTGCCCACCGCGACTTCAAGAGCCGCAATGTGCTGGTCAAGAGCAACCTGCAGTGTTGC
ATCGCCGACCTGGGCCTGGCTGTGATGCACTCACAGGGCAGCGATTACCTGGACATCGGCAACAACCCG
AGAGTGGGCACCAAGCGGTACATGGCACCCGAGGTGCTGGACGAGCAGATCCGCACGGACTGCTTTGAG
TCCTACAAGTGGACTGACATCTGGGCCTTTGGCCTGGTGCTGTGGGAGATTGCCCGCCGGACCATCGTG
AATGGCATCGTGGAGGACTATAGACCACCCTTCTATGATGTGGTGCCCAATGACCCCAGCTTTGAGGAC
ATGAAGAAGGTGGTGTGTGTGGATCAGCAGACCCCCACCATCCCTAACCGGCTGGCTGCAGACCCGGTC
CTCTCAGGCCTAGCTCAGATGATGCGGGAGTGCTGGTACCCAAACCCCTCTGCCCGACTCACCGCGCTG
CGGATCAAGAAGACACTACAAAAAATTAGCAACAGTCCAGAGAAGCCTAAAGTGATTCAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001077401
Insert Size 1512 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001077401.1
RefSeq Size 4126 bp
RefSeq ORF 1512 bp
Locus ID 94
UniProt ID P37023
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, TGF-beta signaling pathway
MW 56.1 kDa
Gene Summary This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform. This variant contains an upstream in-frame start codon, but this upstream start codon is poorly conserved and would result in a protein that is 14 aa longer at the N-terminus and lacks a predicted signal peptide. The downstream translational start codon, as used in variant 1, is selected for this RefSeq based on its better conservation in mammalian species and on the presence of a predicted signal peptide in the protein N-terminus. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...