GPBAR1 (NM_001077194) Human Untagged Clone

CAT#: SC315529

GPBAR1 (untagged)-Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 2



  "NM_001077194" in other vectors (4)

CNY 6270.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal TGR5/GPBAR1 Antibody
    • 100 ul

CNY 6470.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BG37; GPCR19; GPR131; M-BAR; TGR5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001077194, the custom clone sequence may differ by one or more nucleotides


ATGACGCCCAACAGCACTGGCGAGGTGCCCAGCCCCATTCCCAAGGGGGCTTTGGGGCTCTCCCTGGCCC
TGGCAAGCCTCATCATCACCGCGAACCTGCTCCTAGCCCTGGGCATCGCCTGGGACCGCCGCCTGCGCAG
CCCACCTGCTGGCTGCTTCTTCCTGAGCCTACTGCTGGCTGGGCTGCTCACGGGTCTGGCATTGCCCACA
TTGCCAGGGCTGTGGAACCAGAGTCGCCGGGGTTACTGGTCCTGCCTCCTCGTCTACTTGGCTCCCAACT
TCTCCTTCCTCTCCCTGCTTGCCAACCTCTTGCTGGTGCACGGGGAGCGCTACATGGCAGTCCTGAGGCC
ACTCCAGCCCCCTGGGAGCATTCGGCTGGCCCTGCTCCTCACCTGGGCTGGTCCCCTGCTCTTTGCCAGT
CTGCCCGCTCTGGGGTGGAACCACTGGACCCCTGGTGCCAACTGCAGCTCCCAGGCTATCTTCCCAGCCC
CCTACCTGTACCTCGAAGTCTATGGGCTCCTGCTGCCCGCCGTGGGTGCTGCTGCCTTCCTCTCTGTCCG
CGTGCTGGCCACTGCCCACCGCCAGCTGCAGGACATCTGCCGGCTGGAGCGGGCAGTGTGCCGCGATGAG
CCCTCCGCCCTGGCCCGGGCCCTTACCTGGAGGCAGGCAAGGGCACAGGCTGGAGCCATGCTGCTCTTCG
GGCTGTGCTGGGGGCCCTACGTGGCCACACTGCTCCTCTCAGTCCTGGCCTATGAGCAGCGCCCGCCACT
GGGGCCTGGGACACTGTTGTCCCTCCTCTCCCTAGGAAGTGCCAGTGCAGCGGCAGTGCCCGTAGCCATG
GGGCTGGGCGATCAGCGCTACACAGCCCCCTGGAGGGCAGCCGCCCAAAGGTGCCTGCAGGGGCTGTGGG
GAAGAGCCTCCCGGGACAGTCCCGGCCCCAGCATTGCCTACCACCCAAGCAGCCAAAGCAGTGTCGACCT
GGACTTGAACTAA


Restriction Sites ECoRI-NOT     
ACCN NM_001077194
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001077194.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001077194.1, NP_001070662.1
RefSeq Size 1515 bp
RefSeq ORF 993 bp
Locus ID 151306
UniProt ID Q8TDU6
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the G protein-coupled receptor (GPCR) superfamily. This enzyme functions as a cell surface receptor for bile acids. Treatment of cells expressing this GPCR with bile acids induces the production of intracellular cAMP, activation of a MAP kinase signaling pathway, and internalization of the receptor. The receptor is implicated in the suppression of macrophage functions and regulation of energy homeostasis by bile acids. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...