CTDSP1 (NM_021198) Human Untagged Clone
CAT#: SC315501
CTDSP1 (untagged)-Human CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 1
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NIF3; NLI-IF; NLIIF; SCP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315501 representing NM_021198.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACAGCTCGGCCGTCATTACTCAGATCAGCAAGGAGGAGGCTCGGGGCCCGCTGCGGGGCAAAGGT GACCAGAAGTCAGCAGCTTCCCAGAAGCCCCGAAGCCGGGGCATCCTCCACTCACTCTTCTGCTGTGTC TGCCGGGATGATGGGGAGGCCCTGCCTGCTCACAGCGGGGCGCCCCTGCTTGTGGAGGAGAATGGCGCC ATCCCTAAGCAGACCCCAGTCCAATACCTGCTCCCTGAGGCCAAGGCCCAGGACTCAGACAAGATCTGC GTGGTCATCGACCTGGACGAGACCCTGGTGCACAGCTCCTTCAAGCCAGTGAACAACGCGGACTTCATC ATCCCTGTGGAGATTGATGGGGTGGTCCACCAGGTCTACGTGTTGAAGCGTCCTCACGTGGATGAGTTC CTGCAGCGAATGGGCGAGCTCTTTGAATGTGTGCTGTTCACTGCTAGCCTCGCCAAGTACGCAGACCCA GTAGCTGACCTGCTGGACAAATGGGGGGCCTTCCGGGCCCGGCTGTTTCGAGAGTCCTGCGTCTTCCAC CGGGGGAACTACGTGAAGGACCTGAGCCGGTTGGGTCGAGACCTGCGGCGGGTGCTCATCCTGGACAAT TCACCTGCCTCCTATGTCTTCCATCCAGACAATGCTGTACCGGTGGCCTCGTGGTTTGACAACATGAGT GACACAGAGCTCCACGACCTCCTCCCCTTCTTCGAGCAACTCAGCCGTGTGGACGACGTGTACTCAGTG CTCAGGCAGCCACGGCCAGGGAGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_021198 |
Insert Size | 786 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021198.2 |
RefSeq Size | 2655 bp |
RefSeq ORF | 786 bp |
Locus ID | 58190 |
UniProt ID | Q9GZU7 |
Domains | CPDc |
Protein Families | Phosphatase |
MW | 29.2 kDa |
Gene Summary | This gene encodes a member of the small C-terminal domain phosphatase (SCP) family of nuclear phosphatases. These proteins play a role in transcriptional regulation through specific dephosphorylation of phosphoserine 5 within tandem heptapeptide repeats of the C-terminal domain of RNA polymerase II. The encoded protein plays a role in neuronal gene silencing in non-neuronal cells, and may also inhibit osteoblast differentiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212037 | CTDSP1 (Myc-DDK-tagged)-Human CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 1 |
CNY 2400.00 |
|
RC212037L1 | Lenti ORF clone of Human CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC212037L2 | Lenti ORF clone of Human CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC212037L3 | Lenti ORF clone of Human CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC212037L4 | Lenti ORF clone of Human CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG212037 | CTDSP1 (tGFP-tagged) - Human CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 1 |
CNY 4000.00 |