TVP23A (NM_001079512) Human Untagged Clone
CAT#: SC315492
TVP23A (untagged)-Human family with sequence similarity 18, member A (FAM18A)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FAM18A; YDR084C |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC315492 representing NM_001079512.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGCAGGCCCTGGTGGACGATACCGAGGATGTGTCCCTGGACTTTGGAAACGAGGAGGAGCTGGCC TTTAGGAAAGCCAAGATCAGACACCCCTTGGCCACCTTTTTCCACCTGTTTTTCCGAGTGAGTGCCATC GTCACCTACGTGAGCTGCGACTGGTTCAGCAAGAGCTTTGTGGGCTGTTTTGTCATGGTGCTGCTCCTC CTGTCCCTGGACTTCTGGTCTGTGAAGAATGTAACCGGAAGACTCCTGGTGGGCCTTCGATGGTGGAAC CAGATAGATGAAGATGGGAAGAGCCACTGGATCTTTGAAGCCAGGAAGGTCTCTCCGAATAGCATTGCT GCCACAGAAGCTGAAGCACGAATCTTCTGGCTGGGCCTCATAATCTGCCCCATGATATGGATTGTGTTT TTTTTTAGCACCTTATTTTCCTTGAAGCTAAAGTGGCTGGCTCTGGTGGTTGCTGGGATCTCTCTCCAA GCTGCAAACCTGTATGGCTACATCCTTTGTAAGATGGGAGGCAACAGTGACATTGGCAAGGTCACAGCC AGTTTCCTGTCCCAGACAGTGTTCCAGACGGCCTGCCCAGGTGACTTTCAGAAGCCTGGCCTCGAGGGG CTGGAGATTCACCAGCATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001079512 |
| Insert Size | 642 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001079512.3 |
| RefSeq Size | 3397 bp |
| RefSeq ORF | 642 bp |
| Locus ID | 780776 |
| UniProt ID | A6NH52 |
| Protein Families | Transmembrane |
| MW | 24.1 kDa |
| Gene Summary | This gene encodes a membrane protein associated with the Golgi apparatus, which plays a crucial role in intracellular vesicular transport. The encoded protein is likely associated with the late (trans) Golgi compartments, which are involved in the delivery of secretory and membrane proteins to the endosome, lysosome or the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217273 | TVP23A (Myc-DDK-tagged)-Human family with sequence similarity 18, member A (FAM18A) |
CNY 2400.00 |
|
| RC217273L1 | Lenti ORF clone of Human family with sequence similarity 18, member A (FAM18A), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC217273L2 | Lenti ORF clone of Human family with sequence similarity 18, member A (FAM18A), mGFP tagged |
CNY 5890.00 |
|
| RC217273L3 | Lenti ORF clone of Human family with sequence similarity 18, member A (FAM18A), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC217273L4 | Lenti ORF clone of Human family with sequence similarity 18, member A (FAM18A), mGFP tagged |
CNY 5890.00 |
|
| RG217273 | TVP23A (tGFP-tagged) - Human family with sequence similarity 18, member A (FAM18A) |
CNY 4370.00 |
