ECSCR (NM_001077693) Human Untagged Clone
CAT#: SC315488
ECSCR (untagged)-Human endothelial cell-specific chemotaxis regulator (ECSCR)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARIA; ECSM2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315488 representing NM_001077693.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCACCGCAGGAGCCATGCAGCTGTGCTGGGTGATCCTGGGCTTCCTCCTGTTCCGAGGCCACAAC TCCCAGCCCACAATGACCCAGACCTCTAGCTCTCAGGGAGGCCTTGGCGGTCTAAGTCTGACCACAGAG CCAGTTTCTTCCAACCCAGGATACATCCCTTCCTCAGAGGCTAACAGGCCAAGCCATCTGTCCAGCACT GGTACCCCAGGCGCAGGTGTCCCCAGCAGTGGAAGAGACGGAGGCACAAGCAGAGACACATTTCAAACT GTTCCCCCCAATTCAACCACCATGAGCCTGAGCATGAGGGAAGATGCGACCATCCTGCCCAGCCCCACG TCAGAGACTGTGCTCACTGTGGCTGCATTTGGTGTTATCAGCTTCATTGTCATCCTGGTGGTTGTGGTG ATCATCCTAGTTGGTGTGGTCAGCCTGAGGTTCAAGTGTCGGAAGAGCAAGGAGTCTGAAGATCCCCAG AAACCTGGGAGTTCAGGGCTGTCTGAAAGCTGCTCCACAGCCAATGGAGAGAAAGACAGCATCACCCTT ATCTCCATGAAGAACATCAACATGAATAATGGCAAACAAAGTCTCTCAGCAGAGAAGGTTCTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001077693 |
Insert Size | 618 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001077693.3 |
RefSeq Size | 1051 bp |
RefSeq ORF | 618 bp |
Locus ID | 641700 |
UniProt ID | Q19T08 |
MW | 21.3 kDa |
Gene Summary | The protein encoded by this gene is primarily found in endothelial cells and blood vessels, where it is involved in cell shape changes and EGF-induced cell migration. It can enhance the activation of vascular endothelial growth factor receptor-2/kinase insert domain receptor and also promote the proteolysis of internalized kinase insert domain receptor. This gene may play a role in angiogenesis-related diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213303 | ECSCR (Myc-DDK-tagged)-Human endothelial cell-specific chemotaxis regulator (ECSCR) |
CNY 2400.00 |
|
RC213303L1 | Lenti ORF clone of Human endothelial cell-specific chemotaxis regulator (ECSCR), Myc-DDK-tagged |
CNY 4800.00 |
|
RC213303L2 | Lenti ORF clone of Human endothelial cell-specific chemotaxis regulator (ECSCR), mGFP tagged |
CNY 5890.00 |
|
RC213303L3 | Lenti ORF clone of Human endothelial cell-specific chemotaxis regulator (ECSCR), Myc-DDK-tagged |
CNY 5890.00 |
|
RC213303L4 | Lenti ORF clone of Human endothelial cell-specific chemotaxis regulator (ECSCR), mGFP tagged |
CNY 5890.00 |
|
RG213303 | ECSCR (tGFP-tagged) - Human endothelial cell-specific chemotaxis regulator (ECSCR) |
CNY 4000.00 |