TAC4 (NM_001077505) Human Untagged Clone
CAT#: SC315464
TAC4 (untagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant delta
CNY 1320.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | EK; HK-1; HK1; PPT-C |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001077505, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCTTGCCTCGCCCTGCTTCTCCTGATGGAGCTGTCCGTGTGCACTGTGGCAGGT GATGGTGGAGAGGAACAGACACTCAGCACTGAAGCAGAGACCTGGGAAGGCGCTGGCCCC AGCATTCAGCTCCAGCTGCAGGAGGTGAAGACGGGCAAGGCAAGCCAGTTCTTTGGGCTG ATGGGGAAGCGAGTGGGAGGCAGAGAGGATGAGGCCCAAGGTTCAGAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001077505 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001077505.1, NP_001070973.1 |
| RefSeq Size | 564 bp |
| RefSeq ORF | 231 bp |
| Locus ID | 255061 |
| UniProt ID | Q86UU9 |
| Gene Summary | This gene is a member of the tachykinin family of neurotransmitter-encoding genes. Tachykinin proteins are cleaved into small, secreted peptides that activate members of a family of receptor proteins. The products of this gene preferentially activate tachykinin receptor 1, and are thought to regulate peripheral endocrine and paracrine functions including blood pressure, the immune system, and endocrine gland secretion. The products of this gene lack a dibasic cleavage site found in other tachykinin proteins. Consequently, the nature of the cleavage products generated in vivo remains to be determined. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (delta) uses an alternate in-frame splice site in the 5' coding region and skips two alternate in-frame exons in the 3' coding region, compared to variant alpha. The resulting protein (isoform delta) is shorter than isoform alpha. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219000 | TAC4 (Myc-DDK-tagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant delta |
CNY 3990.00 |
|
| RC219000L3 | Lenti-ORF clone of TAC4 (Myc-DDK-tagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant delta |
CNY 5890.00 |
|
| RC219000L4 | Lenti-ORF clone of TAC4 (mGFP-tagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant delta |
CNY 5890.00 |
|
| RG219000 | TAC4 (tGFP-tagged) - Human tachykinin 4 (hemokinin) (TAC4), transcript variant delta |
CNY 4370.00 |
