PRCD (NM_001077620) Human Untagged Clone
CAT#: SC315463
PRCD (untagged)-Human progressive rod-cone degeneration (PRCD), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RP36 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315463 representing NM_001077620.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGCACCACCCTTTTCCTGCTCAGCACCCTGGCCATGCTCTGGCGCCGCCGATTTGCCAACCGAGTC CAACCAGAGCCCAGCGACGTGGATGGGGCAGCTAGGGGCAGCAGCTTGGATGCGGACCCTCAGTCCTCA GGCAGGGAGAAAGAACCTCTGAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001077620 |
Insert Size | 165 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001077620.2 |
RefSeq Size | 2010 bp |
RefSeq ORF | 165 bp |
Locus ID | 768206 |
UniProt ID | Q00LT1 |
MW | 6 kDa |
Gene Summary | This gene is predominantly expressed in the retina, and mutations in this gene are the cause of autosomal recessive retinal degeneration in both humans and dogs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (1) represents the protein coding transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216764 | PRCD (Myc-DDK-tagged)-Human progressive rod-cone degeneration (PRCD), transcript variant 1 |
CNY 1200.00 |
|
RC216764L1 | Lenti ORF clone of Human progressive rod-cone degeneration (PRCD), transcript variant 1, Myc-DDK-tagged |
CNY 3600.00 |
|
RC216764L2 | Lenti ORF clone of Human progressive rod-cone degeneration (PRCD), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC216764L3 | Lenti ORF clone of Human progressive rod-cone degeneration (PRCD), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC216764L4 | Lenti ORF clone of Human progressive rod-cone degeneration (PRCD), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG216764 | PRCD (tGFP-tagged) - Human progressive rod-cone degeneration (PRCD), transcript variant 1 |
CNY 4370.00 |